Pongo_pygmaeus Locus Mono:35:SNORA26
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:35:SNORA26
Pongo_pygmaeus
Mono:35:SNORA26
1
SNORA26
1001..1114
2114
TAGGCTGAAGAGTCAGTTCATTTCAAAGTTGATATCTCTACAACTCAACAACAAAAAGA
CAAACAACATGTAGGGTCCAGCCCCACAGGGTTGGTGGGTTTTCTCCTCGTGTGCGGAGA
TGAGATAGCATAGAAATAAAGACAAAAGACAAAGAGATAAAAGAAAAGACCGCTGGGCCT
GGGGGACCACTACCACCAAGATGCGGAGACTGGTAGTGGCCCCGAATGCCAGGCTGTGCT
GATATTTATTGGATACAAAACAAAGGGGGCAGGATAAGGAGTGTGCACCATCTCCAATGA
TAAGTAAGTCTACATGGGTCACATGTCCACTGGACAGGGGGCCCTTTCCTGCCTGGCAGC
CAAGGCAGAGAGAGAGGAGAAAGAGAGAAACAGCTTACACTATTATTTCTGCTTATCGGA
GACTTTTAGTACTTTCACTAATTTGCTACTGCTGACTAAAAGGCAGAGCCAGGTGTACAA
GATGGAACATGAAGGCAGACTAGGAGCATGACCACTGAAGCACAGCATCATAGGGAGACG
GTTAGGCCTCCGGATAACCGCGGGCGGGCCTGACTAATGTCAGGCCTTCCACAAGAGGTG
GAGGAGTAGAGTCTTCTCTAAACTCCCCCAGGGAAAGGGAGACTCCACGGTCCACTTGGC
AACGGGCGTCTTCCCAGATGCTGGCGTTACCGCTAGACCAAGGAGCCCTTTGGTGGCCCT
GTCGCGGCATAATAGAAGGCTCACGCTCTTGTTTTCTGGTCACTTCTCACTATGTCTCCT
CAGCTCCTATCTCTGTATGGCCTGGTTTTTCCTGGGTTATGATTATAGAGCGAGGGTTAT
TATAATATTGGAATAAAGAGTAATTGCTACAAACTACTGATTAATGATATTCATATATAA
TCATATCTAAGATCTATATCTGGTATAACTATTCTTATTTTATATTTTATTATACTGGAA
CAGCTCATGTCCTCGGTCTCTTATCTCGGCACCTGAGTGGCTTGCCGCCCACACAACCAA
ATTAAAAAATAACACAGAAGGGTAAGGTAAGTCTCCATTAAACCCAGGAAAGAGACTGGA
AATCTCCTTTTTGGATCCTGTCTATAGTCACAGGTGAAATAAAAGAAATAAAAGGAAAGA
AAAATGGGCAAAAGACTTGAATAGACCTTTCCCCAAAGAAGATATACAAATGGCCAAGAA
GCACATGAAAAGATGCTCAACATCATTAGTCATTAAGGAAATGCAAATCAAAACCAAGTT
GATAAAATGCCACTTCACACCCACTAGGGTGGCTAAAATTAAAACAAACAAAAAGCAGAA
AATGAGCATTGGTAAGGATGTGGAGAAATTGGAACCCTTGGATATTGCTGGTGGGAATGT
AACATGCTACAGTTGCTGTGGAAAACAGTGGCAGTTCCTCGATAAGCTAAACATAAAATT
AGCGTATGATTCAGCAATTTTACTCCTGGGTATATACCCAATACAACTGTAAACAGACAT
TCAAACAAAAACTCATACACAAATGTTTATTTTTAGCAGCACTATTCAGAATTGCCAAAA
GTAGAAACAACCCAAATGTCTATCAACCCATGAATGGGTAAACAAAATGTGGTATATTTA
CACAGTGGAATAGTATTAAGCAATAAAAAGGAATGAATGTATGCTACAACATAGATGAAC
CTTGAAACCATTAAGCTAAGTGATATAAACCAGATACGAAGGCCACATATTATGTAATCC
TATTTATTTGAAATAACCAGAATAGACAAATCAATAGAGACAAAAAGCAGACTAGTGGAT
AAGTGATTGCCGGGAGTCTGGAGATTGAGGGAGAGAATGGAAAGTAACTAATGGGTTCAG
GGTTTCCTTTTGGGCAATGAAAATGTTCTAGAACTAGGTAGTGGTGATGGTTGCACAATA
TTGTGTATGTATTAATGTTATTAATAGTAAATTTTATGTTGTGTGTATTTTACTATTTTT
ATTTTTATTTATTTATTTTTTTGGAGACGGAGTCTCACTCTGTCTCCCAGGCCGGAGTGC
AGTGGCATGATCTTGGCTCACTGCAATCTCTGCCTCGCGGGTTCAAGTGATTCTCCTGCC
TCAGCCTCCCGAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved