Pongo_pygmaeus Locus Mono:156:SNORA18
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:156:SNORA18
Pongo_pygmaeus
Mono:156:SNORA18
15
SNORA18
1001..1101
2101
TTCCTCAAAAAATCAAATATAGAACTACCATATGACCCAGCAATCTCACTCCTGGTATA
TATCCCAAAAATATGAAATCGGTATGTCAAGGAGATATCTACACTCTTATGTTCTTTGCA
GCACTGTTTATAATAGCCAAGATATGGAATCAACACAAATATCCAGTAATGGATACATGA
ATAAAGGCAAATATTGTATATATACACAATGGAATACTACTTAGCCTTTAAAAAGAAGGA
AATCCTGTCATTTGCAACAACATGAATGAACCCAGAGGACATTATGTTAAGTGAAATAAG
CCAGGCACAATAACACAAACACTGCATAATCCGTGTGGAGTATGAAAAAGACAGCCTCAT
AGAAACAAGGAGTAAATTGGTAGTTACCAGAAGCTAGAGGTTGAGGATTGAAGAAATATT
TGGTCAGAGGACACAAAATTTCAGTTAGATAAGAAGAATAAGTTCAAGACATCTATTGTA
ATCATGATGACTATAGTTAATAACAATATCTGGCCAGGCGCAGAGGTGGCTCACAGCTGT
AATCCCGGCACTTTGGGAGGTCAAGACGGATGGATTACTTGATGTCAGAAGTTCAAGACC
AGCCTGGCCAACATGGTGAAACTCCATCTCTATTAAAAATACAAAAATTAGCCAGGTGTG
GTGGCATGCACCTGTAGTCCCAGCTACTCGGGAAGCTGAGGCAGGAGAATCGCTTAACCT
GGGAAGCGGAGGTTGCAATGAGCCCAGATCGCGCCAGCACACTCCATCATTGGGGACTGA
GTAAAACTCCGTCACAAAAAAAAAATAAAATAAAATCACAATATCTTGCATGCTTGACAA
TTGCTAACAGAGTAGACTTTAAGTGTTCTTACTATGAAAAAAATAAGTATTTTAGGTCAT
GTATATTTTAAATATCTTTAAATATCAAAACATCATGATGTGCACCATAAATTTATACAA
TTTTTACTTCTCAGTTAAAAAAGATGAGTAAATAAATCATTTTAAATGTCCATCACAGGA
AACACCTTTAGAGTAACTCTGTGCTTTTGCTTTATTCACAGAGCTTTTTGTTAGAACTAT
GGAAAGGAATTACAACATAGAGTGCTAGAAGCACAAGTGGCCTAATAATAATTTTTATTT
TTACCGTAAGTATTGGCATATCTGACACATCTGTCCTATTGTTGAGTATGACACCTTAGG
AATAAATGTGACTGGAAGTCATTCATTTTGAGGTGACTCTTAAGAGTCTTAGGGTCCTGA
AATCAAGAACCAGGCGGATCTATCTACTCTGACACTAAAAAACAGATCCTAAAATAAATT
TCATGAAAAAAATTAGATACCAAAGATTTCTAGTTGGGGAAGTTTTGAGGTTGTCATCAA
TATGTCCATATTCAAATGGAGATCAATGAAGACCAAATAAAAGAATTGTGGGCTATCTTG
AAGATAAATCATGACTCAAGCTTTTGAGGAACTAAGGTGACCTTCACAGTCAGTGGAAAG
GATCACAATATGAAAAGTTATTTCAATAGAGGTATACTGACTTTGGGCTGGGCACAGTGG
CTGACACCTGTAATCCCAACACTTTCGGAGGCCGAGGTGGGCGGATCACCTGAGTTTGAG
ACCAGCCTGGCCAACATGGCGAAACCCCATCTCTACTAAAAAAATAAAAATAAAAATTAG
CCGGGCGTGGTGATGCCTGGCTGAGGCACGAGAATCGCTTGAACCTGGGAGGTGGGGATT
GCAGTGACCCGAGATTGCACCACTGTATTCCAGCCTGGGCAAGAAGGTAAGACTCTGTCT
CAAAACAAACAAACAAACAACAACAACAACAAGATATACACATATATACGTATATATATG
TGTATATATATACGTATATATGTGTATATATATACGTATATATGTGTATAAATATACGTA
TATATGTGTGTATATATGTATATATGTGTATATATGTATACATGTGTATATATACGTATA
CATGTGTTTATATATGTGTGTGTATATATACACGTATATATATACACATATATACACATA
TACACATATATACATATACACATATGTATATATATACTGATTGAATAACCTTGTCTAATG
TT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved