Pongo_pygmaeus Locus Mono:223:SNORA12
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:223:SNORA12
Pongo_pygmaeus
Mono:223:SNORA12
8
SNORA12
1001..1156
2156
GCTAATTTTTGCTTTTTTGTAGGGATGGGGTTTCACTGTGTTGCCCAGGCTGGTCTTGA
ATTCCTCGACATAAGCAATTCTCCTGCTTTGGCCTTCCAAGGTGCTGGGATTACAGGTGT
GAGCACCATGCCCGACCTAAATGTTCACTTTTAATCAGGGCCTATAGCCTTTAATTCCAT
AGTAATGTGGTTCGCTAAGTCCTCCCTAATAGATATTTTCACACTTTCTAAATGGAGGTA
GGACTGAGGGACTGTACTAAATATCAGACAAGCAAGAAGAGCAGCCTTCCCCTACCAATA
CCTCCAGCAACAGTCCCTAGTAACAGGTTTTTGTTTTGTTGTTGTTGTTTTTTAAGAGAG
GCAGCAGTGTGTTCATAATCCTAATGAAAAATGGATCAGGTTGCAGGGAACTGAGGCATG
GGACAAAACAAGAGGCAGGGATAAAAGAAATCCACAGGGCTTTCTGCTTTAATCCAACAA
AATCACATGAAAATTACTCAATTATGAATTTGGAGTCAGGGATCTCTGCCCTATCTGTAT
CTCCCAGAAACATTAAAAACAGGGCCGGGCACGGTGACTCACGCCTGTAATCCCAGCAGT
TTGGCAGGCCGAGGCGGGTGGATCATGAAGTCAGGAGATCGAGACCATCCTGGCTAACAC
GGTGAAACCCCGTCTCTATTAAAAATACAAAAAATTAGCCGGGCGTGGTTGGCAGGTGCC
TGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATGGCGTGAACCCAGGAGCCGGGG
CGTGCAGTGAACCGAGATTGCGCCACTGCACTCCAGCCTGGGCGACAGAGGGACACTCCG
TCTCAAAAAAAAAAAAAACAAAAAAACAAAATCTAAAATTTCCCTGTATACTGGTGCTCA
CTCATAACCCTCTTCCTTGGAACCCTTGTTACGGAACTAGACTTCTCGTCATCTGCCCAC
ATAATTCCTAGGTCTGTCCGAATGCTTTAAAACTATGTATCTCTCGTGGTAGTTTTCTTT
TTGGCACATTTGTTAAGTTTTCAAATGGGCCTAACACTGCCACATGTATTATACTGGAGC
TGGCAAAAGCCTGTGACAATGAGATATCTCTCAAGCCTTTCACGCCTTTCCTCTATCAGA
GAATGGCTCCCACATGTGGCAGGAAAACAGAAACAAAAACAAAAACAAAAATGGATGTCT
CACTACTAGGCACTCAATCAAAAACAAGCAACTATGTATCTCTAATCTTAACCTTTGCTA
ACCTTTAAAATAAAACACTAAGTTTAAAAAATAAAAATACTTCTTTTAAACAAGGATTCA
GACACTAACAACTTATAAAAACGATTATATTCTGTAAATTTATCATTAAGACATTCCTTA
TGTATTTATTACTAGCTTAAGTAAACCTTAAATTCTGAATAACAAACTCCTCGGAGTGAA
TGTGCCTTGCTTTACATCAAACTAATATGCTTTTAAAGATGAATAAAGTGGCTAAACTCC
AGGCTTTGACCTCATTAAACTGAGCAGGAAGGAAGCAGTATGTTTCAGAAGTTTAGTATC
AACAATCCTAAATTAACTATGAATCAGTTTCATGGCTTAATAAAATCACACCAATTATTA
CTCGTGCACTTTGAGAAATGATGGCCATTCAGCTTGCTAAGCAGGGCACTCTAGACAAAT
GCAAAGAGGATTTTCTTTCCTGAGAAAGTCGATACTGGACATTTATTAACATTAACAACA
ATTTAAAACCTGACACAAACTGAAGGAATGAAATAGGTTCTGAATCCTTTGATAGCGTAA
CAGTAATTAACTATGTATTCAGGAAAGAGAAAAACTCATTTGGGCAAAAATATAAAACAT
AAACAATGAACTTAAAATCTTTTTAATTTCCTATTCTCTATTAGTATAGACAAATCACTT
TCTTATTTGAAAACCTTATTAATGTATAAAATGTATTATTAAGAGGCAGAGTCTCAAATC
TTTGAAAAGTGCAAGCAATTATACATTCATTGATTTAATGGGGCTATAAATGTTTCTGGT
ATCCAATTTAAAACTAAACCTCTACTACAGAAGCCTAAAATTTCTACTGCAAGGTATGAA
TGAGGTGGGCAAAAGATTCCTTCTGTTTCATTTTTCTAAATATTTGAATAGTTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved