Pongo_pygmaeus Locus Poly:17:SNORA7
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:17:SNORA7
Pongo_pygmaeus
Poly:17:SNORA7
8
SNORA7, SNORA7
1001..1145, 1799..1943
2943
TTGTAAGTTGTTTCTGTATTTGCATTTGTTTCAAATAAATTTTTCTATCTCTGCTTTAA
TTTTGTTATTTACGCAAAAATCACTCAGGAGTAAATTGTTTAGTTTCCATGTATTTGTGG
TTTTGAAAGTTCCTCTTGTTATTGATTTCTATTGTCATTCCAGTAGAGTCTGAGAAGATG
CTTGACATAATTTCAATTTTTCAAACTTGTTGAGACTTGCTTTATGACAGATCATGTGGT
AAATTTTAAAGAATATTCCATGTGCAGATAAGAAGAAGGTATATTCTGTGGTTGTTGGAT
GGATAATTCTATAGATGCCTGTTAGGTCCAAATGGTCAAGTCTCAAATTAATGTCCAGAA
TTTATTTGTTAGTATTCTGCCTTGATAATCTGTTTAATGCTGTTAGTGGGGTGTCAAAGT
ATCCCACTATTATTGCGTGCCTATCAAAGTCTTTTGTCCAGAGATAATTGTTTTATGAAT
CTGTGTGCTTTGATGTTAGGTGTGTAAATATTCAGGAGAGTTAGGTCTTCTTGAATTGAA
CCCTGTATCATCATGTAATGCCCTTATTTGTCCTTTTTTTACTGTTGTTGGTTTAAATCC
TATTTTATCTGATAGAATAATAGTGACCCCTGCTCTTTTTTGTTTTCCATTTGTCTGCTA
TGGAAAACAAAAGTAAATCGTTTTCCATTTCCATCTCTCTACTTTGAGCCTTTGGGTATT
ATTACATGTGAGATGGATCTCTTGAAGATAGCAGAAGAATGGGTCTTGTTTTCTAAATAC
AATTTGCCACTCTGTGTCTGTTAAGTGGAGTGTTTGGGCCATTTATATTCAAGATCAATA
TTAACATGTCAGGTTTTATTTCTGTCATGGTGTTGTTAGCTGTGTGTTTTGTAGTCTTGA
TGGTGTAGTTGCTTTACAGGGTCTCTGGGCTATGTGCTTGCATGTGCTTTTATGGTAGCA
AGTACTAGTACTGTTCTTTCATTTCCATGTTTAGAACTCTTAATCTCCTGGGATTGTGTC
TGGAGAGTGCCCAGTATTCTGCCACCTTCAGAAGGAAGGGAAAGCAAACCTTCATGAAAG
CAGAGGCATTCATTCCATTCCCAGCTTGCTCCAGATCTGGCAATTGGAAGACATTCTGCA
ACAGTGTCAAATCAGATGAACAAACAAAAAAGAACTCCCTTAAGTATCTCTTATAGAGCC
AGTCTGTTAGTGATAAATTCCCTTAGCAATTGTTTCCCTGAGATATACTTTATTTCTCTT
TTGTTTATAAAGCTTAATTTGGTGGGATATCAAATTCTTAGCTGGCATATCTTTTCTTTA
AGAATGTTAAAATGGGCCACCAGTCTCTTCTGGCTTGTAAGTTTTTCTAAGAATTCTGTT
AGTGTGACAATCTTCCCTTTATAGGTAACATTACCCTTTTCTCTAGCTGCCTTTCGATTT
TTTCTTTGCATTGACCATAGATAGTCTAATCATTATGTGCCTTTGAGATGATCATCTTGT
ATAGTATCTCACTCAAGTTCTTGGATTCTTTACCTGCATGGTGTCCTCTCTAGCAAGTTT
AAAAATTTCCTGAATAATTCCTCAAGTATGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTATTTCTGTCATGGTGTTGTTAGCTG
TGTGTTTTGTAGTCTTGATGGTGTAGTTGCTTTACAGGGTCTCTGGGCTATGTGCTTGCA
TGTGCTTTTATGGTAGCAAGTACTAGTACTGTTCTTTCATTTCCATGTTTAGAACTCTTA
ATCTCCTGGGATTGTGTCTGGAGAGTGCCCAGTATTCTGCCACCTTCAGAAGGAAGGGAA
AGCAAACCTTCATGAAAGCAGAGGCATTCATTCCATTCCCAGCTTGCTCCAGATCTGGCA
ATTGGAAGACATTCTGCAACAGTGTCAAATCAGATGAACAAACAAAAAAGAACTCCCTTA
AGTATCTCTTATAGAGCCAGTCTGTTAGTGATAAATTCCCTTAGCAATTGTTTCCCTGAG
ATATACTTTATTTCTCTTTTGTTTATAAAGCTTAATTTGGTGGGATATCAAATTCTTAGC
TGGCATATCTTTTCTTTAAGAATGTTAAAATGGGCCACCAGTCTCTTCTGGCTTGTAAGT
TTTTCTAAGAATTCTGTTAGTGTGACAATCTTCCCTTTATAGGTAACATTACCCTTTTCT
CTAGCTGCCTTTCGATTTTTTTCTTTGCATTGACCATAGATAGTCTAATCATTATGTGCC
TTTGAGATGATCATCTTGTATAGTATCTCACTCAAGTTCTTTGGATTTCTTTTACCTGCA
TGGTGTCCTCTCTAGCAAGTTTCAGAAAATTTTCCTGAATTATTTCCTCAAGTATGTTTT
CCAGTTTCTCTTATTTGTCTTCTCTCTCAAGAATGCCAGCAAGTCATTGATTTTATCAAC
TTTACATAATCCCATATTTCTTGAAGGTTTTGTTCATGTTTAAAAATTCTTTTTATTTTT
TTCTGCCTTGGTCATTTTGAAGGACCGGCCTTTGAGTTCTTCTGCTTAGTCTACTCTGCT
GTTAAGTCATCCAACTGTATTTTGAAATTCCTGAAATGAATTTTTCAATTCCAGAACTTC
TGTTTGGTTATTTCTTGATATAGCTATGTCATCTTTCATTTTTTTTCCTAGCTTCTGGAT
CATTTTTTCTGGCTTCTTTGTTTTGATTTTCAAATTTCTCTTGGATCTCCTTGAGTTTCT
TTGCCATTCATATTCTGAATTCTGTATCTGTCATTTCAGTCATTTCATTCTGGTTAGAAT
CTATTAAACGGGATCTAGTGGAAGCCTTCAAGGGTGACAAAACGCTCTAGCTTTTTGTAG
TGTCTGAGTTCTTTGCACAGGTTTCTTCTCATCTGAAAGAGCCAAGCGGTTTTTAAAAAT
TCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved