Pongo_pygmaeus Locus Mono:57:SNORD45
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:57:SNORD45
Pongo_pygmaeus
Mono:57:SNORD45
X
SNORD45
1001..1072
2072
CGTTCCTTTGGAGGAGGAGAGGTACTCTGCTTTTTAGAGTTTCCAGTTTTTCTGCTCTG
TTTTTTCCCTATCTTTGTGGTTTTATCTACTTTTGGTCTTTGATGATGGTGATGTACAGA
TGGGTTTTTGGTGTGGATGTCCTTTCTGTTAGTTTTCCTTCTAACAGACAGGACCCTCAG
CTGCAGGTCTGTTGGAGTACTGGCCGGCCGTGTGAGGTGTCAGTCTGCCCCTGCTGGGGG
GTGCCTCCCAGTTAGGCTGCTCGGGGGTCAGGGGTCAGGGACCCACTTGAGGAGGCAGTC
TGCCCATTCTCAGATCTCCAGCTGCGTGCTGGGAGAACCACTGCTCTCCTCAAAGCTGTC
AGACAGGGACATTTAAGTCTGCAGAGGTTACAGCTGTCTTTTTGTTTGTCTGTGCCCTGC
CCCCAGAGGTGGAGCCTACAGAGGCAGGCAGGCCTCCTTGAGCTGTGGTGGGCTCCTCCC
TGTTCAAGCTTCCAGGCTGCTTTGTTTACCTAAGCGAGTCTGGGCAATGGCGGGCGCCCC
TCCCCCAGCCTCGCTGCTGACTTGCTGTTTGATCTCAGACTGCTGTGCTAGCAATCAGCG
AGACTCCATGGGTGTAGGACCCTCTGAGCCAGGTGCGGGCTATACTCTCCTGGGACACTG
TTTCCTAAGCCTGTCGGAAAAGCACAGTATTCGGTTGGGAGTGGCCCGATTTTCCAGGTG
CCGTCTGTCACCCTGGAAAGGGAACTCCCTGACCCCTTGTGCTTCCCGAGTGAGGCAATG
CCTCGCCCCTGCTTTGGCTGGCGCATGGCGCACTCACCCACTGACCTGCCCCCACTGTCT
GGCACTCCCTAGTGAGATGAACACGGTACCTCAGATGGAAATGTAGAAATCACCCATCTT
CTGCGTTGCTCACGCTGGGAGCTGTAGACCAGAGCTGTTCCTATTCGGCCATCTTGGCTC
CTCCGAATTGATTTTTTTAAATGTGGTATGTATACAACATTGGTCAATGATGTAATGGCA
TGTATTAGCTGAATCCAAAGTTGATGTGAATTCTAAAATTACACCAAGACCTTGGGGGAA
AAAAAGAAAAGAAATGTTAAAAAAAAAAAAAGGGCTGTATCTATGACATAAACCTGTTGG
CCCAGCACAGTGGCTCAAGCCTGAAATCCCAACACTTGGGAGGCCAAGGCAGGTGGATCA
CCTGAGGTCAGGAGTTCTAGACCAGCCTGACCAATACGGTGAAACCCTGTCTCTACTAGA
ACTACAAAAATTAGCCGGGCTTGGTGGTGTGCACCTGTAATCCCAGCTACTCGGGAGGCT
GAGATAGGAGAATCACTTGAACCCGGGAGGCGGAGGTTGCAGTGAGCTGAGATCATGCCA
CTACACTCCAGCCTGGGTGACAGAGCGAGACTCTGTCTCAAAAAAATAAATAAAATAAAA
TAAAATAAAACAAAATAAACCTGTAAGACATTATGCTAAATAAAATAAACTGAGCACAGA
AATAAAAATAATGCATCATCTCTCTTATGTGTGAAATATGAAATAATCAAACTCATAAAA
ACAGATAATAGAATGATGGTATCAGAGACTTGGCAGAGAGGGAAATGAGAAGACTTTGGT
CAAAGAGTACACATTTTCAGTTATGCAAGATGAATTGTTTCTGGAGAGCTAAGGTATAGC
ATAAGCATACTCACCGTAGTTAACAACATTGCTGTTATATTTAAAAATTTTTAAGGTTTT
TAAGAGTTCTTGCCACACACACACACACGCACACACATGAAAAAAATAGAAAAGGAAATG
GTAACTATGTGAGGTGATTGATACGTTAATTAATTTGATTGCAGTGATTATTTCACAATA
TATGCATATATCAAAATATCAAGTTGTTCATGTTAAATATATACAATTTTTTTTAGACAA
TTGTATCTTAAAGCTGAAAACAATTTAAAAGTTTTAAGTAAGCAAAAAAGTTTTGATACT
TTTCAAAATCCTCACATCCAATTACTATCACATAGGGAATTAGACATCAACATATACATT
TCTGGGAATATAAATATTCAGTCCATATCATTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved