Pongo_pygmaeus Locus Mono:129:SNORA12
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:129:SNORA12
Pongo_pygmaeus
Mono:129:SNORA12
2a
SNORA12
1001..1148
2148
TTAAGTTACAATATGGAGTAGTAATTCATCATATCAATGATATGGGGTGGGGGGACACC
TTACCCTCCTATTCAACTATGCTATCCAGTTATGGAAAGAAAATTCTTCAGTAAATTTCA
CATGGAAAATCTGAACTACAAACAATTTTGGACAGAATTTTGTAGGCTATAAAAGCAGTA
TACTTAAACAATACCTGTTCAGTTTCTGATTTTGTCTGTCTTTTTCTTGCTCATATTTAG
TCTTCAATCCTTTGAATGTCTGAACATATTCAATCGATTCAAGTGCTTTATAAAAGTTTT
CAACTATATGGGCAGTAAGAGACTTGATATCTTCCTGTATAAGCACAAAATTTACATTTA
AAATATAATACAATGCTTGTTAGAAGAAAAACTTTAAAATTTTGTTTTGTAGTTCTAAAG
CTGATCAAAAAAGGTTTTTCAAAATCACCTTCCAAAATGTAATGTCCTGGTTTCTTTACA
CATGAGTCAGGACTGCACAGAAAACTTGAAAAAAAAAAAGGAGAAGCAATTTACTGGAGC
CCTTTTGTAGGACTATAAAGAACATTCGAAAAGTAAATAGATTCATTTTACATCTTCTGT
TTATTTTTTGTATTATATATATATATATATATAGCAGTTTACAATTTAAAAAGCACTTTT
ACATACAATTTCATTTGATCTTCAAAATAATTCTATGAGATAGGTTTTATTATCCCCATT
TTAGAGAAAAACAAAATTGAGGCTCTAAGAGAGGCTGGATGGTTTGATCCAGAGCACACA
GCTGGTTAGAGGGCAGATGTTAAAATTACATTTTCAAAATACTCACGGTGATGGATACCA
AATATCCGGACTTGATCATTACACATTCTATGCATGTAAAAATAAATACATGTACCAAAT
ACATCTGTACAATATTATGTATTAATAAAAGAAAAACATATTTTTCAACAAACAGGTCTT
ATGTAATGACTTCCTGTTTAACTGCTATCAAAATGGGATATGGTTGTGGTGGTTTTCTTT
CTGGTACATTTGTTAAGTTTTCAAATGAGCCTAACTCTGCCACATACATTATATAGGAGC
TGGCAAAGGCTTGATGACAAAGAGATCTCTCTCAAGCCTTTCCCACATCAGAGGCTGGCT
TTCACACATAGAAGAAGAAAAAACAACAGAAGATACGTCTTACCTAAATAATAAGAAGCA
AAGATTTCTCTGACTATATCATACACACAGATCTGATAAACTATCTGGAACTCTACTTGT
CTATTCCTATAGTCTTCCAATAGTACAATATCTGTGAAATAAACTAATTGATAGTAATAA
CTTCTAAATTCTAAACTATCACTGCAAATGCATGCATGCCCAGTAGGCTTATTTAAAAAA
AAAATTAAAGTTGTGATTCAGGACTTTACAGATAACACTACATAGTAAGAAACACAAAGT
CCATTTCTTGAAAAGATACACCATAATTTGGTTGCATTATGGATTTTAAGTCTTAAAACT
AGTTCTCCTGTACTTCTCAATTAAAAAAAAAAACGCAAATCAGAAATTAGAAACCTAGGT
AATGGCTCTATGTTATATGTGAAACGAAAAAATACATTAAGTTTTGGGGCACAAGGTACA
CAAATCAACCACTCAAACTTATTTTGAGAAAAACAATTCCATCATGGGCATAGGGACAGG
GTTGTAAACCCTACCATTTGCTTTATCTGTATCTCACCAAAATTTTAAAGGAGAAAAATA
TAAAGTAAATAAAATATAAAGCTTTGATTTATTGCAGCAGTACAATAGGAACTAGTGAGC
TAGTTAACCATGTTCCTTCTTTTACCAGGTTAAAGACTTCTATCCTCTTCATCCTTTTAA
AAATCATATACTTGGCAATTGACCACTTTTAGAAAAACAATCCAGTCAGCCAAATAATCT
TCCTATGAGAATAGCATGTTATCAGCAGAAATCTGATTTGTAAGAAATAAAACTGGAGAA
TGAATTTCTAGCTTGGACTTTCGTTTTTCAAATTATTTCCAGCCAGGTGCAGTGGCTCAC
TCCTGTAATCCAACACTTTGGGAGGCTGAGGTGGGAGGACTGGTTGAGCCTAGGAGTTTG
AGACCAGCCAGGGCAACAAAGGGAGACCCCATACCTAAAAAAAAATTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved