Pongo_pygmaeus Locus Mono:145:SNORA73
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:145:SNORA73
Pongo_pygmaeus
Mono:145:SNORA73
18
SNORA73
1001..1200
2200
TTTCCACTACTTTTGCCTGGCAGAGAAGTGAAAATATTGATCTCAGAGGAGATAGCTTT
TTGTTTAGGAAAATATTCTGATGTGTTTTTTTTTTGTTTTTTTTTTTGTTGTTTTTTGGT
AAACAATGCCCCTGCTATCTTAAAAGATAGGATGAAAAAAAAAGAGAGAGAGAGCTAAGC
TGCACTACATAAAAAATTAACTGGAATTTGGGAGCTGGTCACTGATGCCTCATTGGTGGT
TGGAGAGGGCTGAGCAACTTGGCAAGAGGCTGGAAAGAAGCCTAGAAAGAAAAGACAGCC
ATGAAGACATCCAGGTGGAGTAGATAGCTGAGGGGCTTTTAAGAGTAGTGGTGATTAATA
TTCAGTTGTCAATGTTTCCTATTCTGAGCTGTGCTGAAACCATTCATTTCTATCTTTAAA
GCTTTAGTTAAGATCTGCCCAGAGATGTGTTGGGTGTTGGGAGAGAGTGGAGCAGTGCTT
AAGCCTGGGTCAAAGTAGCGTAGAAAGAGGATGTTGGTTATGGGAGCTGAGACAGATAAT
TTGGGGCAGGCTGCCCAATGACTGACCCTGGAGAACAACAGCCTTCCCTTGGGAATCCTC
AAAGGTTTCAGGAAGAGTGTGGAGGACATGGGTAGAGGCTTGAGCCATTTCATTTGGATA
GTGAAGAAAAGGGAAATATCAGGCTCCTGACATGCAGGTAACTTTTAGCCATGCTGAGAC
AGCTGGATGAACAGAATGATGACAACATATCTATCCATCGTCCATCCATCCATCCGTCAA
TTGATTCAATCATTCGTCATTCAGTAAGTACCAAGAACCTATTATATGTGAATTGCTACA
TTATAAGAGACATTGTTTCTTTTGTCCAGATTTCAATTTTAAGTATTAATGTATACACAA
AGCACATTAAAGAAATAAAACCCAAAGCTTCCAGGATGAGGTTGACTTTACATGGGCCTC
GGAGAATGACTTACATTTGAATAAGAATCAAATGAGGGATTCCAACATGGATACCCTGGA
AGTCACTCTCCCCAGGCTCTGTCTAAATGGCATAGGGGAGCATAGGGTCCCATCCCAGGA
TGTACAGTCCTTTGCCACAAGTTAGAGATGAAGCTGGGTCTGGTGTCTGTGCCTGAATAT
TCCTACAGCTTCTGAGTCTTGTGGACAATGACAGAGGAGACAAACCACGCAGGAAATTTG
TCTAGTATAAAATAAAACTAAAAGAAAGAATTAAAGGAGGGAAGAATAACATTCATAGCA
ACTCTTTATATTTAGATACTATTTTGTAATTTATCATGAAATTTCATGTATAATATCTGA
TCTATCATCACAACTGCTCTCTGAAGTAGGTATTATTATTCTCATCTCTCAGAAGACAGA
ACTGAAGATCATAGTTTGAGTGACATATTCCAAAAACATAAAATTAGACCATGTGAGTAA
TTCAATAATCAGAGTAATTGTTACTAGTTTTCTCACAGATCTGAAAATATTCCCTGACTT
GCTCATCATTTTAATCGTTTATATTAAAAGTAGAGGACATATAATGAAATTTAAACTAAT
AAAAGATAGAAATAAGGAAAGATTACTGATTAAATCATTCATTCTTCATCTGAATAGCCA
ATTCCCCATTTAATATGATACAATTCTCAAAAATGTTATGGTCATGTCATTTTTCTGGGA
TGCATCACATAAATGAGAAGATACTTTAGAGCGTATTTGGGTGTTGATAAATGCATCTAT
TGCATACCACCTCTGCTTATTCCTATCCTAATATTATGAACAGTGCTAAAGAAATACTAA
CTATAGTCTCTGCCCCAAAGAAGCTTCTCATCTTCTATGTAGAAGTTTTCCCCTTTCATG
AAAGAACTGTGATGACTTTAACTTCCACCTAAGAGCTCAAACATGGAAACATTTTACCAA
ATTAAAAATAAGCAATTTCTACATTCATTAATTACACCAGGATGAGTTATCAAGAAAAAA
AGTAATTGGTGTAAACATTTTCTTTCCCTACTCCCATTCTGGGTAGAAGAAGTTAGCATT
ATATCTCTAAATGTCCAAGTTGTCCTTACTCCCATGTCTGTAGGGGAAATGGAAACTTCC
TTTCATGACTTTATCCTCCTCATCCCACTCCCCTTTGGACCTTGAGTGTCATTAAGTTGG
GTAAGGAGAGGCAGAACTTTGGCGATTTGGGTGTGAAGACG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved