Pongo_pygmaeus Locus Mono:140:SNORA31
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:140:SNORA31
Pongo_pygmaeus
Mono:140:SNORA31
2a
SNORA31
1001..1135
2135
TCTGTTCTAGACAAAGGAACTTAATTCTAAATGAAACTTCCAGCTCCAACAGGTGAGTC
AGTGTCTTTAGAGCAGGGCTTATCTTGTGGTTTTTATTATTCCTCTTGCCCAAAACACAC
CATTGCAATGTGAACGGTGCCTACCTGCTTACTCACCGGTGAATATTCTCCTCCACATGC
AGAATTAAATTACACAATTTATCACACTGTTTAAACACACTAACCTGTGCGTATCTCTTT
AGATTTTTCCTTCTGATGCCCAGAAATGTCAATTAGAGAGCTTCAGGTACATTGTCTCAG
AACCAGTCTTCAGTAATCATCCCTCTAAAGTCAGAATTTGAAACCATTGTGCGTCAGATT
TGCAAAAATCTCTTCCACTATGAGTTAGTTTGTTACAATTAGTACTTCAAGTGAAAACTG
TTAGCATGCTGAACATCCTTCAAGGAGATCATTTACTCTGTAAACGCATCAGTCTAATTT
AATCGAATGTCAACGTGAGATAAAGAATGCTGTATCTGGGGGCTCTGAGTTTGCATTTAA
AATTCTATTTGTATCTAACCCTTACGATACTGATTTGTATAGTGAAAAAAAAAAAACAAC
AGATTCCCTCTCTTTGTTTTCTCTTTTGAAATAAGTAAGCTTATATTATAAAGACCTTTA
ATAATATGGATTTTTTTTCTACTCTGTAATGCTTTTCTATAAGTATTTCATTGTGGCATT
TCAGAATTATCTTGTGAAAGAGAAGAAACTCTGGCTTTTATTGTAAGTAATGTTCTGACA
ATTATCACTAGTGTAAAAGTACTTTCTAAGAATTTGCCTACATCCCCCTCAAGGGTGATC
TTCTGGCTTCTTAATACATTAATGTTAATATTAGTGGTGATCCAAGAGCCACTCCCACTT
CCATTTCTTTAGAAAGTCTAGAGGCCCCCATCCAGGCAATCTTTCCTTTTGTCACTTAGA
CTCTTTGTGTTTAAAGGTACCCTTTAAAAACTGGGATTGGCCTACATCCACTGACAGACC
TTGGACAGTTTGCTGTTGTTTTTTTTTTTGGTTTGCTCTGGGGATGCAAAAGAGGGAAAT
CCCGGCACTTCCTGTCTGTCTTTGTGGCAGCCTGGATTGAATAGGGGAATGCATCTGTAG
AAAAAAAGGAAAAAAAAAAAAAGCAGGGTTGGCAACTCCACCTCGACATGACTTTCAACA
TGAAGTCCAGAAAACTTGCACACATGTGGAGATAGCTTGGGGGAACAGAGCAGTGTCACA
CACATGCATGTGACAGAAGCACTCCCTGACTTTGCAGGGAGCAAGAGTCTCTGCTCCAAC
ATGAAATGAATCAGGAGGACGCCAGCAATGTCGGCCTCTGCCAATTGGCAAACGGCTGTC
TTCCCGTCAGAAGCTTCTGATTCCCACCCTACAAAATGGAAAGATTCAACCAGGGACCAT
TTGACCTGTGTTAAAGATACTGCTGGCAGACTCAGGGTTGATACATACTTTTGGTTAAAG
AAGCAGAAGATGATATAGTTTTGAGTGTGCAGATTTTTTAAAACAACGTTCTATGTGGAA
AGCACTTACTGAATTAGGAAGCATTGTCCATTTTCACTTTTAAATACATAACTGCATTGT
CTATATAAGATTGGCCATATTTAGTCATCAATGATGTATTTACAATGGCATGATTCATTC
GTTTTTACAAATGAATTTTACAGACTGGAGGGCTTGCTAAAATAAATAAAATAAAATAAA
GAAGAAGTTGAAATGCAAAAAAAATTAGAATAAGTTTGATACACCAAATAAATACTACTA
GTTTCCACACCAGTACCAAAGATTTGGGTCACATGTCACAGATTTAACTCTAAATTTCTC
AGAAATTAAGGGAAAGAGAGGCAAATAACTATATAATGTATCAGTGCAAATCCCTCAGTT
TCTCACTTTATAGCTCACTAGATAAACATGTTCACATAAGTAATTTTAATAATCCTTACA
TGTATGTTTTTACATTTATTCAATCCTCACCTACACCAATGCCTAATGCAGTGCCTAAAA
ACCAAGGACTATAAAACCAGATCATGAAAATTTACCCCGAAGAGTATTTAGAATTGTAAA
GAATTGTAATATTAAACCATTCAATTTGAACTACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved