Pongo_pygmaeus Locus Mono:127:SNORA70
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:127:SNORA70
Pongo_pygmaeus
Mono:127:SNORA70
2a
SNORA70
1001..1135
2135
AGTATGGTAGGCCAGGCGTGGTTGCTCATGCATATAATCCCAGCACTTTGAGAGGCCAG
CGTGGGTGGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGACCAACATGGTGAAATCC
CATCTCTACTAAAAATACAAAAATTAGCCAGGCGTGGTGGTATGTACCAGTAATCCCAGC
TACTCGGGAGGCTGAGGCATCAGAATTGTTTGAACCTGGGAGGCGGAGGTTGCAGTGAGC
TGAGATTTGTGCCACTGCATTCCAGCCTGGAATAGAGTGAGACTCCATCTTAAAAAAAAA
AAAAAGTATGTTAACAAGAATTTAATATTTATAAGCATTATAAAGATTTTAGGCCCAGGG
TAATGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCCAGGGAGGTGGATCACTTGAG
TTCAGGAGTTTGAGACCAGCCTGGTCAACACGGTGAAACCCTGTCTCTACTAAAAATACA
AAAATTAGCCAGGCATGGGGTGCTCACGTGTAACCCCAGCTACTCGGGAGCCTGAGGAGG
GAGAATCATTTGAACCCGGGAGGCAGAGGTTGCAGTGAGCTGAGATCAAGCCACTGTACT
CCAGCCTGGGAGAAAGAGCAAGACTTTGTCTCAAAAAAACAAAAAAAACAAAAAAAAAGA
TTTTAGTATTTTATATATATATTTTTTCTTATTTAAATGATACAGTGATTGTAGGGGGAA
AAAAAAAACTGAGAAACTACAGAGAATCGAAGTTAAAAACAAAAACATGCTACCATTCAG
AGCAACAGCTTACAACTTTTTGTGTATGTCCATGGTGTGAGACTGCGAACAGTACAGTTT
TAAATTTTACAAAAATTATATGTATACTTTATGGTCTCATTTTTCAGGTACAGTTAACTA
TGGTAAGTCTCTGTGTGATAAGTATTATCTGTGTCATGATTTTTAAGTGCTGTTTAACAG
TCATATAGCTGTCACAACTTTGGCTATAGATTACGGAGGTCCTGTAGCCAATTAAGCCGA
CTGAGTTCTTTTCCTTGTGGGGGTCCAGTGTGCAATGGCTATAAACAGCAGCTTCCTTGG
TAGTGTATGCAGCCTGTTTGTTGTATAGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTT
CAGATGTATGTTCATGTTTCTGACCTTGCACTACCCCAATGTAGGCTCCAAACAGGCATG
TGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACGTTGGCCAAGTTATG
TCCATCCATACCAAGCTGCGGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAG
TTCAAGTTCCCCGGCTGCCAGAAGATCCACATCTCGAAGAAGTGGGGATTCACCAAGTTC
AATGCCAATGAATTTGAAGACATGGTGGCTGAGAAGCGGCTCACCCCAGATGGCTGTGGG
GTCAAGTACCTTGCCATTCATGGCCCTCTGGACAAGTGGCTGGCCCTGAACTCATGAGGG
CTTCGACTGTGCTGCCCCCTCTTAATACCAATACATTCTACTTCCTGTCCCTCCTCCCCC
AAAAAAAAAGATTAGGGAGGTTAATAACACATGTTTGTTTACCAGATTATCATCATTTTA
TTAATTTAATGATTGGGAGTAGAATAGCAGGAAAACTAACTCAGAAAATGGGAAGAGAAA
GGAATAGGAGAATAAATTCAAGACTAAATTAGGGAAAGGGCATATACGGATCTGCAAAGG
AATATCATGTATGACAAAAGCGCTGATACCACAGAGCATAATTCTTCATGTTAAGTGTTG
ATTTTTTTTCTTTTTCTTTGCTTGTTTTAAGCTTATTACAAAACTGAGTTAGGTTTATAT
CTTGGAAATTCCACATTCCTTAGCAGGTGTTTAAAGCTCTTTGCTGTCTCCTCCCTATCA
ACTTTTTAACTTTATTTCAGGAATTTCTTCTGTATAAGAACTCTGGATGCCAGCCAGGGT
GAGGTTCTCTGTCAGGTTTCCAGGCTAAAAGTAGTATCTTTTATATTTGTCATTTGTGCT
TAATGTTTGAAGCTTTTACTTTTATTTTTTCATTGTTTTAATAAATTTGATTTTTTAGAA
TAGTTTTAGAAGCCGTTGCTTTTAAATAGGTTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved