Pongo_pygmaeus Locus Mono:263:SNORA7
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:263:SNORA7
Pongo_pygmaeus
Mono:263:SNORA7
11
SNORA7
1001..1139
2139
AGCTCGATGTTGAGGAGAGGTGGACAGCAGGTCACTAACAGCCAGGAAACACACTGGAA
GAACAGAAAAAGAAGGAAAAACAAATGTAACTATCAGTAGCTTTCCCTTGCTTATCTGTA
TCCTCCAGGAAGCCCTCCCTAATGACCACCAAGGCCCTTGCAAATCTGACCCATTTCACA
GCCCTGACCAGAGCTGGACCCAGGGTCTGCTCTCAGTGTGCTGCTCATTTGCCCAAGGCT
CCAAATGGTCGAAGGGCCCCAGCCAAACACTGTTTAGTAAGAGAAATTAGGTCTTTATTG
TTGGTTCCTGGGATCCATCAATGGTCAGTTGTTAGAGGGATGGCTCAGCATAGGGGTGTC
GCTTCTGTGGTTCACTGTCCCAGGGTCTTGCCATCATCTCCAGTGCTTACCCTGCCCTGT
CACTCTCATCTCCCAGGCCCTGGAATTCAGAGTTCTCTAAGGCAGAAGCCATTTCCTTTT
CTTAATATTTCTTCTGCAAACTTTCTGAGAGTGGGGAACAAGTTTCCCCAAACCCCCAAA
CAAATTTCCCCAAATCAGAGAAGAGACTTTTCAATGGTAGGAATGACTCCTCATCAGGGT
TGTGGGCTCTCTGAGGATCAAAGGCCTTCTGCAATACAGACTAGGAGCTGGCTGAGGTGG
GTCAATACCACCTGGTTTGGTCAACATGCCTCTCTTCTTCCTCAACAAAGAGCCCAACTG
TGTTTCCCTAAACAGATGAAGAGCTACCTAGGATGAGAGACCTGGCCCTGTTTCTTCCTC
TAGACCAATAGAGGGGGAAATTTTCCCTCCCTTGAGGCATTTGGTAAAATCTGGAGACAT
TTCTGTTTGTCAGAACTGTGTGTGGGAGGGGTACTACTGTTATCAGGTGGGTAAAAGCCA
GGGATACTGCTAAACATCCTACAATGCACAGGACAGTCCCCACAATGAAGAATTATCCAC
CTCAAAATGTCAATAAAGCTGAGGTTGAAAACCCTGCTCTACGGCTTCCAGGATCACCCC
TGCAGAGTGGCTAATATTCTGCCAGCTTCGGAAAGGGAGGGGAAGCAAGCCTGGCAGAGG
CACCCATTCCATTCCCAGCTTGCTTAGTAGCTAGCCATGGGAAGACACTGTGCAACACTG
TAGAAAACCCTGTCCTAGGCCAGGCGCGGTGGCTTGTGCCTATAATCCCAACACTTCAGG
AGGCTGATGCGGGTGGATCACTTGAGGCCAGGAGTTCAAGACCAGCCCGGCCAACACGGA
GAAACCCCCATCTTTACTTAAAAAAAAAAAAAAAAAATTAGCCGGGTGTGGTGGCGTATG
CCTGTGATCCCAGCTACTCGGGAGGCTGAGGCACTAGATCACTTGAGCCCAGGTGGCAGA
AGTTGCAGTGAGCCAAGACTGTGCCAAGAAAAAAAAAAAAAAAAAAAGCCCTGCTCCATG
GCCTGCCCAGCTTTCCTTGGCAGCAGGGCAGAAGAAGCCAAAGAAAACTTATCTAGGAGC
CTGGAAAAGGACTGATTCCTATCCCAGCCTCTTCAAAGGGGCACCTCAAAAACAAATGCA
CATCACAGTGGGGAGTGAGACTAGGCACAATTTAATCACAGCCTCAGCATCAACCCACAG
GAGCACAGCACAAAGAAACAACCAACCATGGCTTTGTAGAAACAGACACGCCAGGCTCTT
CACTGAGGAAGAGGAAGAAAGGCATGGTGACCAAACCAGGCAGGGGTAAGGCAGAGATAT
TTATAGTCCTGCAAATATCTGTTTGTCAGAGTTGGCCAGCACTGCTGGGGTTCTTAAACC
CTTGTACCCGCCTTACCACTGGAATCCACCGATGGGTTCTGCAAACCTGTGCCGGATCAG
GAAAGTGGCAACAGCTTCAGCTACCTGGAAATGGGAGAGATATTCCAGGCCATATAAAGG
TTAGTGATGGGGCTTAGCCTTGGGCTGTGGGCTACTTGTTATATGGTTAGGCTCTATGGT
GCCCTCATCCCACCCACAGGTCTGAGTGGCTTGAAATTAAAAGGACCTAGGCCCTCCCTA
GCAGAGCTAGAAGACTCCTCCCCACCATCCTTGCCAGGGATAGCTCCATAGAGCTCAAGA
GGAATGACGTGAAGGGCTTATTTGTGCCCTTAGTTACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved