Pongo_pygmaeus Locus Mono:235:SNORD44
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:235:SNORD44
Pongo_pygmaeus
Mono:235:SNORD44
13
SNORD44
1001..1061
2061
ACTCTCTCCATCACCCCTTGGGCCAGGGAATCCATGTGAGTGGGTCTGCCAAGAAGACC
AAGTGAAAAAAATGAGAGTCTTCCAATGATGTTTTGAGTGCCAGGTCCAGGTGCTTTTAC
ATTCATGACATTGTTCAGTTGTCACAATAATCCTACCATGTAGGATTTAATGTCTCCACT
TTATGGATTAGAAAATTGAGGATTAGAGAAGTCACCAACCAGTGCTCCAGGCAACTGCAG
GTCACGATGCTGTGACCTTGCCTCCGCTGACTAAAGGCTGGAAAGTCTGGCTAAACCTAC
TCGTGTGCATATCACCTATGAATTAGCATAGTCAATAAATACTAGAAATGTTATAGTTGT
TTTAACTTTTGAAATGAAATTTGTTTTTATTGTGAATTAATTAATGACTGAGAAGGCCCT
CTCTTCCTATATAACATGGGTTATTTTTATTTTTATAGCATACAATATTATTACAATATT
ATACACACACGTGTCAGCAGACTCTTCCTCTTTTGAATGACAATTACTCAAACTCACCCC
ATTGACAATATCTAACTCTTCGGTGAAGTCTTTCAATAATTGCAGCTGTGCTTCTATATT
CAAGGACTGGAATAAAGTGAAATATTGACCCTGGTCAGCTCCGATTCAGAGAAGATTTTG
ATATACCAATTGTATTCCTATTCAACAATTTGTACATTCCATGCTAATTGCATCTGGCTT
ACTACAGAGGTTGAGTGTTGAGAAAAAAGAACGGGGCAGGAGAAGATGAGAGGGAAGCTT
GTGTTCAGTTAAACATAAGTACAGAAATTCAACAAACCAGTGAAATTCATTATTTTATGG
CTCATCAGTTGGTTCAGCTTAAGTTCTTGGATAAACTGCACAGAAAAAATATTACCGCTT
TAGTGAAATTACTGCCTCTAATAAAGAATGGGTAAGCAAAATCTCAAGTTATATAATTTT
TTTTTGATGAAGTCAATTCCAAAAACGTGAAAGCCACTGCCCTGGGGTGACGATAAGCAA
ATGGTGCCTGAATGTGAAGGTCATATTCGGCTTTAGCTGATTTCAAACAAACAAACAAAA
ACAAAAAACAAAAACCCTCCACTACAAATGATGATTTCAGAAAGTTATTTCACCCCCGGA
CTCTCCATGTAATGAGAGCACCATCCTTCTACCTGCATCCTCTTCTTCCTTCAAGCTCCC
CCACCATGAGGCCCGACCCTCCCAGGGTTGCACAGCTGCACCCCACAATTCAACACTGAA
ATCTCGGGGTTCCTCCGCCACATCCGCACAGCACATCTGCCCTGAGCAATTGTTCCCTGC
CCCTCCCTCAAAAGACCTAGGCCCAGTTCCACCTCACAGCTGAAATTAGACATCCAGCGC
ACTGCACACGCCCGGGCAGGGATGCTTGCTGGAACTGACATCTGTCCCAATCAATCCCCA
CCTTCCTGAACGGCACATGCACCTCGGCAGGAGATGAAGCAAAATTCTGTGGTTAGATAC
ACAGAATTTTAATAGTGAACTTTAGCCGGAAGGTGAAAATACATTCTTTTCTGTACATTT
AGAATTAATGAATCCTATAGACCTGTGGAAACTGCTTTTAAACATCTGATTTTCCATTAA
AGTATAATTAAAATCAATGGCACAGAGAAGCTTTAGTTATTTTTACACTGGCACCCCCCC
TCCTTGGCAGGAGAATATTTGCTCTGTATATTTTTAAGAGGGTTTGGGGGGCATTAAATT
ATGCTTTGATTGTATTCCATCAATGAAAATATAAGACACAAACATCTTATTTCTTATTAT
AAGAAACAAATAAGCACTTATTAACTGTGTGTGCATTCATGGGACACACAAATGGTCTCA
GGCTGAGCTTATAGTAAAGCAAATTAAAATTAGTGTTTTGACTTCTGTTCATTATAAAGT
AGATACTAGCCTAAAGATTCCTAATCAGTTGCCAAATACCTATCATGATGGAATGTGCAA
TGCAGAATGAAATCGCTGTCCTCAAGAGAAAGCTCTGAGAATTCTTTTAATCTACATAAG
GACAAATTTGCCTTTCGTCACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved