Pongo_pygmaeus Locus Mono:54:SNORD43
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:54:SNORD43
Pongo_pygmaeus
Mono:54:SNORD43
X
SNORD43
1001..1059
2059
CTGCTCAAGGTACTAGTTTTCTTGTTTCCATCCCTCTTTAATATAGTGTACACCCATAA
TCCTGGACACACTTTTCCTGTGTCTGATTAAATTCATGTACCCTTTTCATCAGGTTTAAC
TTCCAGGTTATCTAAATGGGCTTTCCATAAGAAGCAACACACTGGAGGAGGTTTTCTTTT
CTTTGCCTTTTTGGTAACTGGCCTAGGAAACAAAGATTCTGTGTTTTACCAAGATAATTT
CCTGTGCTTCATGTCTTTATTAGGTTTTTGATTATGTTGGAAAACTAACCTTCAGAAAAG
TTCGGGTTTCTACATCCAAATAGCATTCTGTATTGCTTTTAAAGTCTTTTGGTTATCACT
CTGGTTAAGAGAATAAATATTATTTTACAGTCATCTGTGATTCTGTTTAATCAAGGACTT
TGAACCTTTTGACATCTTTGGCAGGTATCCACAGGATCAAAATCCTAAGTCTTTTTGACC
TAAAGCTAACTTTGGGATTTTCTAGTTGGGCCTTGAAGAGCATAAAAGAATGTGTTTCTC
ATCTTATGGAAATATTAAATGATTAGGCTTACGTGGTAAATTGTATGGGAAACATTGTTA
ATTGATAAGTGATTCTGGATCCTTTCTCAGTTACACTTATGGGTATATTATTAAAATATA
TTTCAAAACTACAGGTTCATACAAATCTAATATGTTATCAGTCATAAATCTGGATATTAT
TAATATGAGTAGTCCAAAAAATTACATGAAACTTGTAAAAGTCTGATGGTCCTGATGTGA
AGATGTCAATTATAATTCTGGTTGTTATCTTAAAATGCTGCGTATAGTAGAGGTGGCTCA
ATTTCCTTGTCAATTGTAAACTCTCATCAGATTTTTGACCATGACTGTTCTGGGTTTTTG
TCATCCACGGTTAATGTTTTAATTCTTCTCTGGAAGCAGTTGCAATCAGCTGTAGTCCAA
AATTGCTTTTCATGGAATTGCTAATCAAGATCAAGTAAAACAACGGATGATGAAATTATT
GATGGGTGGACAAAAACTGCTGATTGTCATGTTCTGATTTGGCTCTGTCGCGTTCTCATG
GCCAACATGTGTCCGTGTAGCTCCTGTCTGGGAGCTGGAGGAAGCCTATAGCACTTTTAG
CTGCTACCCAGCATTTGTCCCAGGAGTCCCTTTAGTGGTCAAAGTATTGCCAATTGGCAC
ATAAGGCTATCTGTTAAGCAATTTTTAATGCCACTACTTGGTGTGTTTTTGTCTCGTGTT
AGAAAAAAGTGGATGGCTAGTTTTCTTACAAGTTGAAAGGATTTCAAATAAGGTTTAGTG
TAAATTTTGTTGAGTACAAAAGCATTCTTGACGTGTGTGAGCCTAGAAAAGATAATTACC
CCTTTACTTGGCTTGCTGGGTGTCTGGTCAAGATTGAGTACTGCTGAGAATATTTAGAAC
TTAGGCAACTGGGAACTAGAGAGTAAGGGCTGCTTTAGTTTGGATGCTAATGGTGATATT
TTTTCCCTACGGGGAAAAAAGATTGAGTAAAACAAAATAGTTTATATAAAATTAAGTAAT
TGACAAGGCTGTTGTTTTCATGACTTATTGAAAACATTGTTTTTTCCTTAAATGTTTTGT
TCTCCCGATTTAATAAAACTTTCTTTCATAAGCTATCTATAGTCTGCAATAATTTGGAAA
AGTATCTTTTTTTATGAAAAGGTGGGAGCATTTGCTTTTTCTCCCTAATCGATTTCTCAA
AAATTCAGAAACTAGTCATAAATATTCTTATTTTTATTTATATAAGCTCAGTAAAAATTT
GCTCTCTCTTTATAAGCAGGATATAATTGGAAACAATGGTTATGTTATCAAGGTTTTGAC
TGAAATGTCATATTTATGAATATGCATAAAATACCTGGCTTCAGATATTGTCACTTCCTG
GAGGGCCCAAAAACCTTAAGATTTTAAGTAACATTTTGGTTTTCTAGCCTCAACAGGTTT
TTAAATCTAGGATTCCTATATGATCAATGTGGAGATAAAAAGTTATGTTTCTGAAGAAAA
ACTAAAGTACACCTGTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved