Pongo_pygmaeus Locus Mono:297:SNORA27
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:297:SNORA27
Pongo_pygmaeus
Mono:297:SNORA27
5
SNORA27
1001..1126
2126
AACAATAATAAGGTAACTACATGTGTAAACATAAAAGCCCATAATATTGCATTGTTGGT
TTGTAACTCCTCTTTTTTGCCTATATGATTTAAAAAACAAATGCATAAAACAATAATTGT
AAACCTATGATAATGGACACACAATGTATACAGATATAATGTGTGACATTGGCAACATAA
GGGGAAAAGATGCAGATATATGGGGTAAAATCTTTATAGATATTGAAGCTAAGTTGGTAT
TAATTCAAGCTGGATTGCTATGTGGTTTTTGTTTTGTCTTTTTTGTTTGTTTGTTTGTTT
GTTTTTAGATGAGGTCTCACTATGTTGCCCAGGCTGGTTTCAAACTCCTGAGTTCAAAAG
ATCCTTCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGTGCATACCCTTGTGCCTGGT
GAGACTGTTTTAAATTTAAGATATTAGCTGGGTGAGGTGGCTCACGACTGTAATCCCAGC
ACTTTGGGAGGCTGAGGCAGGCAGATCACGAGGTCAAGAGATCAAGACCATCCTGGCCAA
CATGGTGAAACCCCATCTCTACTAAAAAATACAAAAATTAGCTGCACCTGTAGTCCCACC
TACTCCGTAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGCGGAGGTTTCAGTGAGC
CGAGATCACGCCACTGCGCTCCAGCCTGGAGACAGAGCGAGACTCTGTCTCAAAATATAT
AAATAAATAAATAAAATAAAATACATTTAAGATATTAATTGTAATCTCCAAGATGGCCAC
AAGGAAAATAAATGGGGTTTTTTTGTTTTGTCTTGCTTTTTTAGACAGGGTATCACTCTG
TCACCCAGGCTAGAGTGTGGTGGCACGATCATGGCTCACTGCAGCCTCAACTTTCCAGAC
TCCAGTGATCCTCCCACTTCAGCCTCCTGAGTAGTTAGGACCACCACAGGCCTGCGCCAC
CATGCCTGGCCAATAGAAAAATAACCTTTAAAAATATGGAAAAACCCCTGTTCACTTTGC
CAAATGGATTTGTGTCTTTATTGCTCATTAATTGGGGCAAAGGAAATATCCTTTTAAAAC
TCAGGCAAACTGAGTGTTTGTCTTATATCCTGTCAGAGGAAAGAAACTGAAAAAGAATAA
AAAGGAAAAAAATATCAAAAAGGTAATGCGAAAAAAATCAACACAGCACATTGCAAAAAA
TCAATTAAATACAAAAGGCAATATTAGAGGAATTAAGAAACAAAAATATATAGCCAAATA
GCAAGATGGCAGGAGTAAGTGTTTGTTATCAGTGATTACTTTAAAGGTAAATGGAATAAA
CTCCCCAATTAAATAACAGAGTTTGGAAGAATTTTTTTTTTTTTTGGTTGGAAGAATAGA
TTTTTAAAAACCCATAATTTATCTATGTGTTGTCTACAAGAGACTCATTTTATTTTCTTT
ATTTTTTTAAGAGACAGGGTCTCACTCTGTGGCCAAGGCTGGAGTACAGTGATGTGATCA
TGGCTCACTGCAGCCTCAACCTCCCAGGCTCAAGTGATCCTCCTGCCTCAGCCTCCAAGT
AGCTGGAACTACAGGTGTGTGCCACCATATCTAGTTATTTTCATTTTTTTGTAGCTATGG
GATCTTACTATGTTGCCTAGTCTGGTTTCAAACTTCTAAACTCAAGTGATTCTTCCACCT
TGGCCTCTGAAAGTGTTGGGATTACAGGCATGAGCTGCCGTGTCCAGCCAAGACCCACTT
TAGATCCAAAGACACAAATAGGTTAAAAGTAAGAAGATGGAAAAAGATATAAAAGCGTCT
GTGGTGGCTATAGAAATATCACACCAAATAGACTGTAAGTCAAAAATTGTTACAAGAGAC
AAAGAAGTATATTATATATTCATAAAAGATTCAATTCATCAAAAAGATAAAACAAATATA
AACATGTATGCACCTGACAATAGACCAAATATGTGAAGCAAAAATGGACATATATGAAGG
TAGAAATAGGTAGTTCTACAGTAATAGTTGGAGACTTCAGTACTCTACTTTCTTTTCTTT
TCTTTTTCTTTTTTTGAGATAAGATCTCACTATATTGCCCAGGCTGGTCTTGAACTCCTA
GGCTCAGACAATCCTCCTGCCTCAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved