Pongo_pygmaeus Locus Mono:136:SNORA42
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:136:SNORA42
Pongo_pygmaeus
Mono:136:SNORA42
2a
SNORA42
1001..1136
2136
CCTGCGTCCCCGCGCCGGCCCCTTTCCCAACCCGTCGGCGGCCGCGCGCTGGCCGGGGA
GCCGTTGGGGAGGCCCTGGCGGCCGCGCAGCAGGTGCAGGGGCGCAGAGCCCGGGCTCGC
CTTGGTACAAACGAGCGGGCCCCGGCCTTGGCGCCTTCAGTTTCCTTCCAGTTTTTATTT
TCGCTGTGTCTACAGAGCAGATGACACCAATTTGGAAACCCGCGAGAGTGGGTAGAGCTA
AGATAGTCTTGTAGTAGCTGTGGTATTAGATGCTCGGCCATGACTTAGAGGTGTTTATTT
AAGGACTGTGAATGACTCGGTGATTTCGGAAAAGCTTGGCTCAGATGAACGGACGTACAC
AGGGGAGACAGCCCTCACGTTTGCAGAAAAGGCTGATTGTGCTGTTTGCGAAGTCGAAAT
AGTTGGTGAAAGTGTAAAAGGCAGAACCTCTCAGGAATGTCTGGGGAGGACAAAGAATGT
GTTGGCTGACTTTGTTTAAACATAAAATTGGGCAGACTTTAATTGACTTGTGAAATTTTT
TTCAAAGTTTGTTTGAATTAGCCCCATCTCTTCTAACATTACCGTCTTGTGCTAATTGAT
TCACCATTTTAAATAACTTAGCTGTTACAGAAGGACCAAAAGGTCTTCTTCAGTAAAATA
TATTCAAGTAAGTTACTTAAGTAACGCTTTAAAAGATACAGAAAAGCAAAAAAGTGTTGG
CGTATTAAAAAGAAATCAAAACTTTCCAAGTTTAGGCCTGAACATTGCCTTAAAAATATT
TAATAAGGCCTTAAATGACCCAGTCAGTGACTGCATGAGCCTATTTATTATTAAATTGTA
AATATTCTTCATATAAACAAAAATACATAACCATGTCTGTAACAAAAATGGTTTTGCTAG
CGTTGTTACTCTCTTCCCTTCTCCGAGGGGTGATTTAGGCAACTTCGGAGGTTGACAATG
CCAAGTAGTCACAATAGATAGAGCTTTAAAGCAAATTCTATGCATGGGTTTGGATTTATG
ACAGGCCCGTCACCCTGGGCCTGTCATAGTACCCCATGCCAGAGCAAACTGTGTCCCCGA
ACCATTGCCTGGCCTCTGTGCCCGTAGGCTGCTGGCACTGAAGTGGGTTGCACAGTGGAA
AAGAAGAAAGCTCTCTACCTGGCAGAAATTTTTAAAGGTTAAAATAAATAATTTTAAGAA
AGCTGGTTCACAAGGTGCCACATTTGATGAAAGCAAAATACAGTGGCTTTTATTGTTGCT
AGAGTGATGTTCTTGCTTATTTTTCTTATTGGTGAAGTTAGCCCCAAATTATTCTCATAG
CTAAGCAAATACGAGAGTGACTGTAAGGACAGTTGGCATTCCCGGAATTGCTAAACTTGG
TAGGCAACGCTGGTTTAAGAATACTGAGTTCTAGCCGGGCGCGGTGGCTCACGCCTGTAA
TCCCAACACTTTGGGAGGCTGAGGCAGGCGGATCACCTGAGGTCAGGAGTTGGAGACCAG
CTTGACTAACATGGAGAAACCCCATCTCCACTAAAAATATAAAATTAGCCAGGCCCCGGG
TGTGGTGGCACATGCCGGTAATCCCAGCTACTCGGGAGACTGAGGCAGGAGAATCGCTTG
AACTCAGGAGGTGGAGGTTGAGGTAAGCTGAGATCACGCCATTGCACTCCAGCCTGGGCA
ACAAGAGTAAAACACTGTCTGAAAAAAAAAATACTGAATTCTGATCAGGTAACAGCAACT
GTAATACAGTGTGATAAGTTGACTTGAAGATTACAGTTTTTAAGAAGTATATACCCAGCT
AATACATGAAAATTAACTCGTAAAATCTCAAATGCTCAAGACATTTCCATGATGCCTGTT
GGTCAGTAAAAATCGTTCTAAGACTTAGTGGAAGTAGGAAATAGCAAGATGTTTGTACGG
CTGTGTATAAAGGCTATAATGTAATCCCAGCACTTTGGAAGACCCAGGTGGCTGGATCAC
CTGAGGTCAGGAGTTTGAGACCCGCCTGGACAACGTGGTGAAACCCTGTCTCTACTAAAA
ACACAAAAATTAGCCGGGCGTGGTGGCAGGCACCTGTAATCCCGGCTACTGGGGAGGCTG
AGGCAGGAGAATCGCTTGAACCCGGGAGGCAGAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved