Pongo_pygmaeus Locus Poly:16:SNORD50
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:16:SNORD50
Pongo_pygmaeus
Poly:16:SNORD50
6
SNORD50, SNORD50
1001..1070, 1292..1364
2364
GCAAAAGATGGTGGCGCAGGCCGAGTTAAGAGCTTTAATCCTGTGAAGCCATCTTGGTG
AAGAGCTTAGAGTGCTGAGAGTTGAAAGCTTGCACGTGGGAAACGTGCGGCGCGACCGCC
ACATGTACTGAGGTTGAATCGTGACGGCCACAGGCTCCGAGTTTTGGCGTGAGGAGACCG
CTGATCGGCTACGGGCGCCGAACTTGCTGGCCTCAGGCATGTGCCTGAGCGGCGGCGGAA
AAACCACCTCAGTTGGGGCGGAGGGTTAGTTTTAAGAGCAAGGGGCCTTTACTAAAATGG
CGAAGGCCTTCCGTCGGCGTTGTTTTAAAATGGGAAGCCTCGACCCAGTATTGAGACAGC
TGTTCGAAGGCGGCGTTGTGTGCAATTCGGATTAATGAAGGGGAAGGGTTTTGTGTGGAA
AAACACCTTGGAGTGTGACATTTCTGCGAGAATGCTTAAATACCGATTTCCCGCAGGAAC
AATGGCGCTGTCTTCAGTGGCACAGCGGAGCAGTTCTGTGAAGATGCAAAGGTAAGAGCT
TAGTTAAGCTTAGTTTCCAAACTAAAGGAGTAAACCTGTTGATTTACAGGAATAGGAACT
GTTGCATAGTTTGAAATTTACTTTTTTTTGTTAGATACACGAAAAAAATTCCAGAACATC
TGGGAGAATATTTAATGGAAAATCGCTTGGTTAAAACCTGACACTTAACAGGTATGTGTT
GTTTTAGTACTTTATGATTGAGCATAGCATTTAATCCACACCTAGACTAAACCGAATTTT
TTTTGTCATTGAACAGCATTCTGAGTGTGGACGAGTAGCCAGTGAAGATAATGAATGTCG
GATGTCACTGACTAGCAGCTTCATTTTGAAGTAGGTTGTATGGCTTAAAAGTTCTGTAGT
GTTTGTACTGTAATACTTGCCTTTTAGCTTTACCTTGGTTTGTGGTCAGTGTCACAGAAG
TGCAGTTTAATGTGTGTACATGTACAAGGTCTCATTGGTCTAATCAATGATGAAACCTAT
CCCGAAGCTGATAACCTGAAGAAAAATAAGTACGGATTCGGCTTCTGAGATTAAGACCAG
TAATTCAGAGGTGGAGTAAATTTTGTTGCCGTGATTTTTTAACAGTTGTGTTATAAAATC
CTGGGGTTTTTTTTTTTTCTGCCAACAGTGAGGGTCGCTGTCTGCCCATTGATAGAGGCC
AGATTGTCTTGGAAGTTCCAAAGTTGCAACGATTTCTGTAAGTGGAGTTTTTCTGTTTGC
TTAGAGATTAGTGAATATCGTGTCCTTGGTCTTATCTGTGATGATCTTATCCCGAACCTG
AACTTCTGTTGAAAAAAAAACTTTTACGGATCTGGCTTCTGAGATGGACCGTTATAAGGA
CAATACTTTTTTTTTTTTTTTTAAATACTTTTAATGCTTTTACATCAGCTGTTGGAATGT
TGGTAGTCTTGTAAGAATCTCGTGTTTTTCCTTTTCTAGGGCTAGTGCCACGAGGTTTAC
TTGACTGTTGTGTGAAAAGCTGATAAGAAAACCATCCAGAAAACAGCTCTTCGTTTTACA
AACATGAAAATAAAACATGTAATTTTGGATTATGTTCCTTTTTGTTATTACTTCTAAATA
GGTCCTGAAATAACATGGGGAGCATTAAATGGAAAATCCACTAACCAGCCTTGTAATCAA
ATTACTCTGAATGAATGTTTCGGGTTTGTGCAGGGTACGATGTAAGGGTTTTTGGATCAG
TGTAAGAGTGGAGAGACAGGAATTAAAAGTAATTGTTACTAAGCAAATCATGGAATGTTT
AGTTTTGTTGTAACTATAATTTTGAAAGCCTGGATGCTTAAGTTGAGAAGCGGGGGAATG
AGATACAGAAAATAAAGAGCACAATAGAACAATATTAGCAGTTTATTAAGTATGGTCATG
AGGGAAGGTCACTGATAAAACAATCTGGTAAAGATATTCAGGCTTGCTAAAATCTAGGAA
GAGGTCATTTGGCAGGATGGGTTACATAATACTATCTGATACTACCAAATAAAATGAGAG
AAGCCTTAGGCATGTAACATTTGGAGATAGAAAATGTACCTTCACTATGAAGGTAGTGTG
TGTAAGATGGCGGTTGAAAGCATTGCTTGCGTTTATATTTATACCCTTGATCTCTGATGC
CCTTACCTACTGTACTTAAAACTGTTAATCATTGTCTTTCTCCCCCTCCCACAACTTCTG
CATAAAATTTTAAGATCTGTGTTTCATTAGTTCAAAAGTGCCTAGAATAGGGCCAGGCAC
TGTTATACAGTATGTGGTAAAAGACTATTGAGATTCTAGTTTTCAAGGAAGAGTGCCATT
ACCCTTTTGTTAAAGCTGGCAAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved