Pongo_pygmaeus Locus Poly:21:SNORA25
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:21:SNORA25
Pongo_pygmaeus
Poly:21:SNORA25
11
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32, SNORA25
1001..1125, 2657..2788, 3761..3899, 4129..4258, 5170..5290, 5619..5751
6751
AGCTGCTTTGTCTAAAAAGAGAGCTACAAAAGCCAAAAATACTGGAAAGAGAGGCCTGA
AAATGTGACAGGATCATGAATGTCAAAGGTGAAGCATATAGAAAAAACGACTTCATAGAA
ATGAATAAAGATAAATGTGGATATATGTACCAGTCTGGTGGTGAAGAAATTCTGAAACCC
AGAACTTTATAACAAGAAAAAAAAATTTTAACCCTGTGAAGAAGTTTGTGAAAGAAACTT
GTGAAGTAGTAGTAATTAGAAAAACACCATTAAAACACTAGAGAAAATACATAGAAAAAT
TTGAGAAATTGTCATTTGATTTCTGAATAAGAGCTTACAGGTGTCCTGTGAGTACTGAAA
CAATGAAGTGTAGTGATTTTAATTTTGAAAAGAAAATCTTAAACAAAGAAAGTAACTTGA
CACCCAACCATCTTGAAGAGGGTATTTGAAATGCTCTAATTTTATCCCAGCTTTGTTCAG
CCATGGCAAAAGTGACCTGTCAGATGCTTAGTATTGTAATAACCTCATTTTCCTTCCCAA
ATTTAGAGTATCTTTAATACTATTTTTTTTTAGACAGAGTCTCGATCTGTCACCCAGGCT
GTAGTGCAATGGCACAATCTTGGCTTACTGCAACCTCCATCTCCCGGGTTCAAGCGATTC
TACCTCAGCCTCCCTAGTAGCTGGGATTACAGGCGTTAGCCAGCACACCCAGCTAATTTT
TGTATTTTTAGTAGAGACAGGTTTTCACCATGGTCTCGAACTCCTGACCTCAGGCGATCT
GCCTGCCTTGGCCTCCCAAAATGCTGGGATTACAGGTGTGAGCCATGGCACCCGGCCTAA
TACTACTATTAACTACCATTTTCACTTTTTATTAGTTCAACAAAAGGTGTACACATTTAT
TTAACATGTATACATGGGGAGAACCAGTGATTACCCCGATGTTCATTATTTTGATCACCA
CGATAGAGCTGACTACTCTGCTATGTAGTACATTTTGGGACGGCACTTATGTATGTTTTT
GTTTAACGTGGACAAAGACTTGTGGATAGGTGCAAAAGTAAATCCTCTTTTGCAACCCAG
AACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGGGATATTATGATACCTGAGAC
AGCTGATCGATGGGAGTACTGATAGCCATAAAGGCTGGTTCCAGGCCAGGTGCAATGGGT
CAAGCCTGCAATCTCCACACCGAGGTGGGAGTATTGCTGAAACGAGGAGTTCAAGACCAG
CCTGGGCAAGAAAGTAAGAAACACCTCATCTCCACAAAAATTTAAAAATTAGCTGGGTAC
TGGGGCATGTGCCTGTAGTTGGAGTTACTCAGAAAGGGGAGGCTGAGGCAAAAGGATTGA
GCCCAAGAGTGGGAGGCTGCACTGAGCTTTGATGGCACCACTGTACTCCAGCCTGAGTAA
CAGACAGACCCTGTCTCTTAAGATAAAAAGGTTGATTCTAGGCCTGTAGAATAGATAAAC
AGCATGGGATATGAGGGAAATCCTCAGCAGTATTAATTTTGCATTCCAATTTCATGTTGA
CGATATATACAATGGCTTTTTGTTTTAAAGGCTTTTATCTTGAGAACATGGTGTCTGGAG
TTAAAGGTATGTCTCAATTCGAGTTTTCACATCATATTTGTTTATGTGTAGGAAACAGTA
TGTTGTCAGAGCAAGCAAGTTTCATTTCATTCAGAGACATTTCTACCATGCTTTTAATTC
CCATTTATAATGATTTCTGAAAAGAAGGATCTTAGATTCACACATTTTATAGTGATGTGT
CAGATTCATTTTAGTTGCAAGCATTAGAGGGTCCCAAATTTGTTAGTTTGTAGCAATAAT
CAGAACTTTGGATTTCCTACTTGAAGCCTACGGCATTATTTTGAATTAATGCACAATCTA
AAATGAGGTAGAGGATTTTATGGTTTAATGCAAAATATAGTATAATAAAAGAAATGATTA
CACAGGTCATAAGAATTCATAAATTTGAATGATGTAGAGTTTGATTAAAAGTTATATAAT
GCCAAAGTCATAACTTACAGGCACATTATATTCCTGTATTTTATAATGGATGACAACTAA
TTTTGAGCCAAGAATTAAAATTTGCTGAAATCTTTGAACTGGGAAAACATCCTCTGTTGC
AGTATTGAAGTTCATAACAACAGTTACATTTTAAACTTAAATCTTAAGTTTAAATCCTTT
TCCTTTGGTTCATGTAAAGGAGCTACTTCATGGTACTTTCTATTTATCATTCCTCTGGCT
CCTAAGCACAATGTGATTGTGAAATTATTGTTTTTGTGATTAACGTGATAGGAAGTTTTT
GCAGTTTGCAATATTGTAAGAGCATATTGCAGTTTCTGCTCATAATTTCTTTCCTATGGA
GTATTAGACTTTGTTATTTATGTGTATGAATACTAGCTGGACACAGTGGTGCTTGTGGTC
CCCAGCTACTCTGGAGGCTAAGGCAGGATAAACACTTAAGCCCAGCAGTTCGAGGCTACA
GTGAGATGTGATCCTGCCGCATCCCACTGTAGCCTCGAACCCCTGGGCTCAAGCGATTCA
GCAAGAATCGCACAATTTTTAAAAGACACGGCAGATCCTGTGTCTTTAAAAAAAAAATCA
AAACCTTGTAAATAGTGGTTGAGGTCTATCCCGATGGGGCTTTTCCTGTAGCCTGCACAT
CGTTGGAAACGCCTCATAGAGTAACTCTGTGGTTTTACTTTACTCACAGGACTATTGTTA
GATCTGTGGGAAGGAACTACAAGACAGTTGCTAAAAGTTTGAAAAAGACGGTTACTAAAC
GTTATGAAAAACCAGATAATCTACTTTTTTACCTTAGGTATTGACATACTCCACACATCT
GTACTATTCTTGAGTGATCGCTTAGGTAAGTTTTAATTGGTGACAGTATAATCTTTTGGG
AAATAATGATTACAGTTCAGATGATGAATTTAACTGTTCAACTGCTGAATGATGCGGGCA
TGAACTAAAACTTAATTCTGACAGAGCTGGATGTGGCTGTATAATAAACTGGATCTTAAA
TTTATACTTGGGTTTTAGTTTGAATAACTGGAAATGTATCCGTTCTAAATCTTTAATTGG
TACTTTCTATAGGAATGAATGTGATTTGAACTCATTCATGTTGAGAGGTAAGTAAAATAT
TTAACTTATAATAATCAAGGACTCAAAAGATGAAAAATAGAAATTAAGTACACCATCCCA
ATATTTCAGGTATAACACAAAATTAATAAGATACTGGTAAAAAATTACAATATATATATT
TGTATAGAGAAGGAAAATGAAGAGACTGCATGTCTATACCTACCAAACGAAACTACCTGT
GTTCTTTGCATCGTTATTCAACTGGCAGTTACACATACTTCATCCTAAAGTCACGTAAAC
CTGTGTGGATATGTTGAATCAATAGGGATATGAATTACATAAAAAGAATTTTGTGTAACT
GGCAGTTTGAGCAACAATGAGCTTGACGTTTGTAGTCGCTTGATCTGTTAAGTTACATGT
ATATGTAGGTTTTATAGAGAGACTGGGCAAAGATTAGGCAAAGACTAGAGTTGTAGCTTA
AAATGCAGTTAATGTATAGCTTCCTTATTACAGTGACAATTAGGAAAAAAAGTCAAATTA
TTGTACTTGTTAAAGGAACTTGAATTTGAGAGGTTTGTGAAAGCATTTCTCAGCAATATT
GCAAATTTGGCAATACGAGTTGTACAGTTCAGTCATAATTGTGCACTGCATGGTATCTGC
ACTCAGCAGTTTACACCTGCTAGGGTGTTCAAAGGTCAGTGCTATAGAAATTCAGTATCT
GGCATCGTTGGTTTTCTTGGCTTTGTGCTTGTTAAACCTGGTATTTCTATTGATACAGTA
TTTGTATAGGTTTCCCAGAGTGTTCAGTTTGGTATACTCTAAAATAGTAAGCAATGCTTT
TCTTTTTCCAGGGTGTCAAATTGAGAACCAGGCAGATCCCCACCACCTACAGTAAAAAGG
TAAGATTCTCTGTTTCTACTGATTCTGCTTGTTTCCCTCTATTGGTAGCACTGCCAGCAT
AACAAGAACTTCATACAAATACACTACTAAGCTTTAAAGACTTTTACAATGCCTCATTCT
AGAGAATGGGCACTGTTGATCATGGTGTCCAAAAATAGTTAATGTGGCTAAATTGAGACA
GGTTATGCTTCCATCACAGTATGCATATTGCAGTGGTGACAATGAGACCTGTAACATTTT
GCCATGCTTATGAGTAAAATAGGAGAAAAATGTTGACTTTTCAATATTAGAAACAATAAC
ATTTAAGTAATAAGGAATTTTCAGCTCTTATAGGACCACTGTTTTTTTCTATGCTGTATA
TTGACTGAAACATTGTAATGTGGTACATGACTGTGTCTTGGATCAGGTGTCAAAATATAA
GTGTACTTTGTACAATTCAACTTCTAGGACCCTAAAGTAAATTGGTTGAAGAAATTAGAT
CCCAAAGATTCTTGGTAAGTTAATTCATTACTTAAAAGGCCATGCAGGTTATTTTGTTGA
ATACTAGCTTTTCTCCAAATGTTATTTTAGGTTATTATATTTATTTATCTAGTAATGCTA
TTGCAACATCTATCACCACTTAGGAGTAAAAAAGACTAGACTTACGTTATTAGGTGTTTA
AACTTCATCATTAACGATGTTATGATGATGGGCGAAATGTTCAACTGCTCTGAAGGGGCT
GAATGAAAATGGCCTTTCTGAACATCCATTTACATTAAATATTCCATTGTATTTCAGAAG
ATTATAAAAGCTCAAAGGTAAAAGTTACCAGAAACATGATCATAGAGCAAATTCAGATAT
GAATGGGCATGGGATCATTGATTTTTAAAAATACCTATTAGTTTAAATAGCTATTTTAAG
CATGGAATTTTCAATACCTTAGTTGGGGTGCCGGGTTTCAGGATACTTTGGAACCTAAGC
AACCTCATTCTTGAAAGATAGATTTCTGTACTTAATAGTAAATATAAATTTGAAATACAC
ATTTTTCCATAGGTGAATTTTGAAGTCTTCATCAGTATACCCATATTAAAACGAGACGAC
AGAAGCCAAAGTAATTATGGCAAGTAATGGTTTTTATCTTAACCATAAGTTATTCGCTCA
AGGGTGTAAATGGTCATTACCAAGGCTTTTAGAATGCAGTTTCTCATTTGCTGTGGACAT
GACCATAAAAAAATTTCCCAGTAGGTTTTCTGTCTGCTACTTTGCTAGCAATCAGCTTAT
TGGGAACAGCTGATTAACCGTAATAGAAATGCAATACAAATGCATAATGTGAACCACGTT
ATTTTTCTTTAAAATCAATGAGATTTGAAAATTCTTCTAGATCTCTTGAATCATGCAAAT
GTGCTTTGCCTTTGTATTGTAACCCTTGTGGATTGCTAATAACCAAGCAGTTTGTAGTAG
AGTTAACTCAGGCTCGTTCTAGGACTCAGTCAGGTTCACTCACTGTACAGTCATCTCTGG
AAATGTAAAATTTACTTTTATATTGTTATGTAGGGCTGACAGGACAACTGGATCAGTTTC
ATTAAAAAGGTATGTATGCATTAGAAAAGACATTTGTATGGGTCATTTCAAAGAGGGCTC
ATGAGGCTGTGAAACCCAGAGCTCTTAACGCTGTGACCAAAGATGGAAGTTCTCTATAGG
AAGCCATAGCACTCCTATGTTTGGTGCTGTGTTTTCCTGAGGAGATACAAAACGTAATAA
TCCATGATTGTTGCCATGTGAGAGTTTTAAAGGTTAATCAAAATTTCTCTTCTTCAGGGC
AAACTTGAAGATATATCTTTTGACTCCAGCTCTTTAGAGGATCTAAAGTGACCCTGATGG
ACAGTGGAAGAAATCACAACATGGAATTCCTTGAATAAAAATTTATTGACTTTAAATAAT
TTTGTCTAATGCTACATATGCACAATTAAAAAAAAAACCTTTACACTGTTTCTAGAAAGT
CAGCATGTATTTTTGATTCGAAGTTTCTCTAGTGTTTTCTGTGGAAGGAATAAAAATTTG
AATTTCAGTTGTGTACTTCATGCTTGAAAAATTAGGTCCTTCCCCCTCAGTTACACTCAC
CTTATGGAATTCTTTTGCCCTTGCTCTGTTTTGGGCATAAGCTTCTTGTTTTGCTTTTTC
TTCCTTTTGTTGTTTCACTTCAGCTAGTTGATTGTATAACCTGTAAAGAATTTATATAGA
ATTAGAGACAAACATTGCAAAAAGTGAATCACTTAAAAAAAAAAAAAAATTAACCCTACC
TTAGACCCCTTTGGTGCCTTAGAGCCTGTGTAGTCTTTCTGTCTTCAGGAAAAGATGCTC
TGACTTTATTCACGCCCTTTAGATGACTCACAGATGAACCTGAGGAAAGAAAAGTGAAAT
CAAGTTGTAATCACAAGGCTTTAAACATTTCAGGGAGTTAGTTGTTGAAGATTTTAAAAA
TTCAACATACTTATAGATGGTTTCTCTTTAACTGTTTTGATTTGAGAATTTTCAGAGACA
TGAATTTTATTCCTTATTTCTTTCTGCCTCTGGTGGGATCTTTCCATAAATGATTTTTTC
CTCTTTATAAATGCTTCTTGTAAGCTCCCTGGTATAGGGGTAAGCCTTCGAGGGGTTTCT
GCTGGGGGGAAAAGAAATTTGTGACAGAAATAGGCAAAGTATCTACTTTCCATTAGAAGT
GCGGCGGCCGTCCAAGGCTTACCTGTAGATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved