Pongo_pygmaeus Locus Mono:169:SNORD18
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:169:SNORD18
Pongo_pygmaeus
Mono:169:SNORD18
15
SNORD18
1001..1070
2070
CTGGCTAAAATGGTGAAACCCTGTCTCTATTAGAAATACAAAAAATTAGCCAGATGTGG
TGGTACACACCTGTAATCCCAGCTAATCAGGAGGCTGAGGCAGGAGAATCGCTTGATCCT
GGAAGGCGGAGGTTGCAGTGAGCCGAGGTCGCGCCACTGCACTCCAGCCTGGGTGACAGA
GTGAGACTCCGTCTCAAAAAAAAAGGAACTACCTTAAAGTTTGAGGTAGTTTATTGTGAT
GACTGAATTAGTTAATATTGTAAGGCACTTTATAAGAGTGCCCAGCACATCAGTTATTTC
ATGAATATCTCTAAAATAAATTGAGTCCAAAATAAACAACAAAAAAACTGGAGGAAACAA
AAACAACACACAGAGAACACTACACACATGACCTGCACATGCATGCAGACATCGCTAAAA
AAGCCCAGCAGCCCTCAGACTCGAATGCGCGACAGAGATATTCAGAGAACAAAGAAGAGC
TCTTGGAAATTGCCTTGATAGAAATTTTAAAATTCCATAGAAGAGTTAAAGATAAAATCA
AGGAAATATCCTAAAAAGTAGAAAATCAAGAGATGAAAAATAGAAAAGATAATTAATGGA
AGTCTAACATGCAAATCATAGAAGTTCCAGGAAGAGTGAAAAAGAGAAAAAGAAAGTAAA
AAGAAATAATGCCAGAAAAATGTCTATAAGAGGATGTATATTTTCAGACTGAAGGTGCCT
CTGAGCAGCAGACACCAAGGGTGGGAAGGGGGAGTGTCGTTTATCAAAGTCTTGCACTGC
TATCTGATCATTTACACTAGATATTTAATAAAAAATAAAAAATGAATTAGAAACAAAACA
AGCAAACAAGTATTTAGCTTTAAATGAACATCAAGACCCAGACCCAGACTCAGAGTATAT
ACAAGGGAGAATAGGAGGATAAAAGGTCAAGAAAGGAATTTCTAGCAAGGAGGGTTAAAA
GACCTAATAATAAATATTTAGTCAAGGGGGGGAAAAAAACTCTATTATGATGAGATTACG
CTCTGTGGTCCGTGTTTCTGAAACACATGATTTTGTGGAAGTTCTCATTTGTAAATAAAA
ATTTAAAAACCTCCTAGAATTAAAGTTGCAGATCTTGGCTCAGTATGAGAGATGATTTCT
AACAAGTAGCATTTTCAAAATAGGGAATGAACGCCCTTGTGAGAGCATGAGTTCATGAGT
TGTTCAGGCAAATGCTGGCTAACCAGTGAACAAGGTTATGACATTAGAAGAAAAGAGACA
ACAAATCTGCCATTTTATAACATACAGCCACAGGTTCAAAACACAATCTTTGGGTTACGT
TGTTTTCAAAAGTAAGTAGTTGAAATACATGGTATGTCTAAAATATTGTTTGTACCGTCA
TAGTCTGTGCTGGTTTCTGGATTCGGCTCCTGCATACTCATTTTCTCAGGTTTTGACAAA
AGATCTTTTGATGTGCTAAGAACATCCTCTTTTCTGTCAGAGGTGTCAAGGTCCTTTAAC
ATACTGCAAATAAAAAAAATGTTAAGCCAATCATACTACAGGCTAGACTCAATAAATGTA
TAATTTTGAAACCCTTAATATTTTTCTACAACTGATCAGACAATATATAACAGAAAAGAG
AAGTAGCTTTTTAAATTTCCTCAATTATAAAACTTCTTTAGCTGGTCCTCAAAGTTGTCC
CTCCTCTGGCCCCAAGAGCCCTTTTCAACTTTATCTCCAATTACGTCCTTTCAGTAACAC
AAGGGTTCAATCATACTGTACCACTTACATTCTTCATATAAGCCCTGCATTGCCTATTTT
GGGGATTTTGCCACTGATCCTCTCAGTTTGGAAAACCTGCCATTCCAATCTCTTTGTACC
CAAATCACACCTGTTCTTCTAGCCCCAGCCCAAGCATTACTTCTCCAGCAAGTGATTATT
AATGTCTCTTTTTTCTGAGATTTCAAAGCACTTTTTTTGGACTTCTCTTATTATGCAAAT
ATATGTATATGTGTTTTTGTGTGTCTGCATATATAATTACCTCACCACACAGATTATACA
AAAACATATTAACATATAAACCTGGTCAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved