Pongo_pygmaeus Locus Mono:260:SNORA23
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:260:SNORA23
Pongo_pygmaeus
Mono:260:SNORA23
11
SNORA23
1001..1182
2182
TGATTTTGGTATGCTACTATCAACTAATCTATGGACTTTTTTAAAGTTTCACAAGATTT
CCCACTGTGTCCTTTTTCTGTTCCATGACCCAGTCTAGGGTCTCACATTGCATTAAGTTG
TCATGTCTGATTATGTAAGTGTTGATATATAAGTGTCATGTTTTTAATGTTGATTTAATG
TGCAGTTTAAGGAACTCTTCTAAAAAGCTTCTTTGCACTTAGAAAATACTCACCTTGAAT
ACTGAGAGTGCCTTTTTAGAGAATCACTTGAATCTGGGAGGTGGAGGTTGCAGTGAGCCG
AAATTGTGCCACTGCACTCCAGCCTGGGCAACAGAGCAAGACTCTGTCTCAAAAAAAAAA
GAAAAAAAAAAAGAGTGTGCCTTTTTAGATAGCCAGTTTATTCATTTGAAAGCAGGATTT
TTCTCAGGTTATGTTATTTTCAGCCAGAAACTTTATCAGACAAGTTTTTTCATTTTAAAA
GTTTCATAGTAACAGATAAAATTAACCAAACTTACATCAAACGCTATTGCTGGTAAGATT
TGGCATAATGGCTTTCTAATCCAGGAATATAAAAACGTGAAAATGTGTTTAGTGGTTTTT
GGTGGTGAAGTTCTGAAATAAGAAAATTGGTTGTGGATTCTGGGGTTCAAAGAATGAGAA
TAAATATATGTAACATTAATAGTAATTTTTAACAGTGTTATATCTGTTTGGAAATTGAGA
TGATTACATTTGGAACTGTATCAAAATAATTGTTGTTTATATTTACAGAAAAAGATCTAT
AAAGATCAGATGGAATATATGTTGCAGAATCATGTATTCCCTCTCTTCAGCAGTGAACTA
GGCTACATGAGAGCAAGGGTATGTTTTAAAGCTGCATTATTTATATACTTTTGTCTTGTA
ATGAATGACTCTGTGGACTTTTATATTGAAACTTTTAAATGTTCACTTTGAAGGCTGTGT
TTTATTTTAGGTTTCTGTTTAATGTAAATCTTTACATGGCTGCTGTAATGTGTGCATAGG
TTTCATCTGTGTCTGGTAGCAGAGTCTGTCTGTGTTTTGCATTCAGATCTTGCTATCCAC
ACAAACGTCATGCAGCCAAAGAGTAACTTGGGATCATAGTACTGGTCTAGTGTTGTCTCT
GGACACATCTACCCCTGGCCAGCCTCCAAATTCCCACACACAGAACTCAGGGAATAGAGA
TTAGCTTGGGGGAATTTAAGGTAAGGTATCTACACTAACTCACTGTGTTTTTACAAAAGG
CTTGCTGGGTACTTCACTATTTTTGTGAAGTGAAGTTCAAAAGTGATCAGAACCTTCAAA
CAGCCTTAGAGCTAACGAGAAGATGTCTGATTGATGATAGAGAAATGCCTGTTAAAGTGG
AAGCTGCCATTGCCCTTCAAGTATTGATCAGCAATCAAGAAAAAGGTAAAGGATTTTTGT
AAGTCAAGAAAAGTGAATGTTGGCCAGGTGCGGTAGGTCACACCTGTAATCTTAGCACTT
TGGTAGGCTTAGGTGGGAAGAGCGCTTGAAGCCAGGTGTTCAAGACCAGCCTGGGCAACA
TCTCTACAAAAAAAATTTTTAAAAATTAACTGGGCATAGTGGCTTGTACCTGTAGTGCCA
GCTACTTGGGAGTCTGAGGCAGCAGGATCACTAGAGCCCGACAGTTTTAGGCTGCAGTGT
TCTATGATTGCCACTACTCTCCAGCCTGGGCAACAGATCAAAACCCTGCCTCTTATGAAA
AGATATATATATCTATATATAAAATATATATTAATTGTAAAAAGCCATAATCCTAGAAAC
TTGGCATACTTCCTTTTTATGTGAAAGTACTTTTTAAAAAAACTCATTGATATTTGTTAT
ATCAGGTTTTAAGAAGTTTTAGGGGTTTTATGCAAGTTTTTTACTCTTTCTCTTACAGCT
AAAGAATATATCACACCATTCATCAGGCCTGTAATGCAGGCTCTTCTTCATATTATAAGA
GAAACAGAAAATGATGACCTTACCAATGTAATTCAGAAAATGATCTGTGAATATAGTGAA
GAAGTTACTCCTATTGCAGTAGAAATGACACAACATTTGGTATGTTGTTTGAACCTACCA
TATTTGCAAGCATTTTAATGTAGCTCTCAGTATGTTCCAGGTTGTGTCACAAGTGGCTTG
CCTTACCTTATAGCAGTCCACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved