Pongo_pygmaeus Locus Poly:28:SNORD113
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:28:SNORD113
Pongo_pygmaeus
Poly:28:SNORD113
14
SNORD113, SNORD113, SNORD113
1001..1069, 3510..3581, 6083..6154
7154
TGTATGCCAGATCTGACTTATTTGTTATCCAGTGATGGAGATCATGGCTGTCACTTATG
TGGATAAGAAGCAGAGAGGCACATTAAGTAACAGAGTTCTTGTTCTTGCTTCGAAGGGGG
CTATTCATGTTGTCCACGGAATTAATTCAAAGGAATGAATGGCTACCACAAACATAAATA
GAATTAAAAAATGCTGAGAGAGTGGATGTGAAGTGTTCTCACCACAAAAATGACAACTAT
GAGAAGTAATGGTTATATTAATTAGCTAGAGTTAGTCATCCGACAATGTATATATACTTC
AAAACATCATGTCGTACGCGATAAATACACATAATTTTATCTGTCAATTAAAAATAAAAT
AATAAAATCAAAACCAATTAAACAATGCCATGCATGGACAAATATTGGGAATATGTAATG
AACCATAGGTTAAAATGAATTCATTTTAGTACAGCTGAAGTCCCTTACAAAGATTAATTT
ATTTTGGTACAGCTGAAATCCCTTACAAACATAATTGGAGGGGGTTGTATTCATTTTCAC
AGTTGCTTAATATTCTACTCTATTGTGCACCATATTTTAAGAAGATTTCTCTATTGATAA
AGATCTAGGCTTTTACATTGTTGGGGAGGGAGCACCTACAAATACGGAACAAATTGCCAG
TGTTCCAGTTGTGGAATGAGATGATAGGCTGTTCGTTGTACTGCTGTTAAGTTATGAGTA
AATTAAGTGAAAGACGATTGAGCAAAGAGCAGTGGCACACGGGATGGGTAGGAAGCAAGG
TTATTGATTAATTATAGGCACAGTCTGAGGCCCAATTAAAAAGAGATCTCGTCTACCAGC
TCTGTGGGAAACGAGCCTGGAAATAGCGTTCTGCAGCAGTCAGAGGTCTTGTTCTTGGGT
TTTTGTGATTCATGGATATTAAATTATTTTGTGGGTGAAACCATGAATGAAATAATACGC
ATAATCAATAAACAGTGCATAAGTAAATACACGAGGAAAAAGTGAGTGATGAATAGTTCT
GGGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCCATTAGAAAGAGA
CCTTGCTCTTCTCTGTAAGGGAGTGGAGTTCAGAGTAAAAGTTCTGTTTCTTGGGCTTTA
GTGCTTCCTAGGTAGGGAATGTAAGAGAATCAATGAATGCATTAACAAAGAAATGTGTAA
GTGAAGATAAAGACTGTCATTTGTGGACGATTTATGACAGCATGTCATGAAACAAGTATT
TCTAGTAATATATTTGTAGAATACTGAATTTCAATATAATACATAGGCAAAAGCTGTCAT
TTGGAGTACATAGGAGCTCCAGACACACAGAAGCACATAGACAGATGCATCTAAGTGTCC
ATGTTGGTATTCTGGATTGGTAAGAGGTTGCTAGCTGTCAGCTTATTAAGAAGGAAAATA
TTTACGTAAACAAAAGATTACATGACTGTAATAGAAAAGGAGCAAATATGTGCCAATTTG
AGGATGTGTTACATGACACCAGTTATGATCGATCTAATTGTATCCACTGAATTTTATAAA
AAACAACGAAAATGGCAAGGGATAGAGTCGGTTATTTCTATGGGTTGTTTTGTTTTGTGT
TCAAGTTCAAGTATAGAGTCTAGGATCTCTGGTAATTATATATTGTTTTTTAAGTGGAAT
GAATATAATTATATCTCAAGGGCCAACTCTGGACAGTGTGGAGCATATGATGTGGAATAA
AGCTGATGACTAATCCCGTTCTACCCTACTCATGTCCATAGAGAGAAAGTGGGATCTAGG
TGCTTCTTACTTGGGTTAACTTGGGTTAAGTTCATAGAGAAAGATCATAGAATATTTCAG
TTCTGGGCTGCTGGTGGGTTTACTATATTTTATTGAGAGAGGGCCAAACATGAACCAATA
TTGAGAATGTGTCATATGACCAGGGTTATAATTAATCCAACATTATTTAGTGAGTTTTAT
TTTTAAGAAAATTAAAATAGGTTTTTTTTTGGCTGTAGCTATGGGCTATGAACATGTAGA
CAGATATTGACAGTTCTTATCCTTTGTCTTGGAGTCCATTGTTATTGATATGTTGTTCTA
AGGGAATAAAGGAGGTTATTCATATCTAGATCAATTATTTAAGAGAAGGCCAATCATGGG
CCAATGAGGAACATGTGTTATGAACCAAAGATAATGATTACTCTGGTTATACTCTAATGT
TGTCCAGATAAATAGAGCTCCAGGTTGCCCCTGCTTTGGGCAAAGCACACATTGAAATTT
CCATGGAGTAATTCTTTAGAAAAACAGATATGTAATTTATTCCACGCATGATTGTATATA
TGAGTAAATAAACGAATCACTAGATATGTAAATCAGAAAGATTCTGCATTATTGATGAGA
ATATGCCATAAAACAAAGGTTTACATTTATCTAATTTTGCACAAGTGAGATCCTCTAAAA
GTGATCACCTATCTGTTAAATTTATGGATAGGGAGTATGTAGACAGATATTTATGATAGA
TAGGCTCTTATTCTCATGTTGATATTCATTGTATTATTTAAAAGCCCAAACTACACAAGT
CAATAAATAAGGAGTGCCATTTTTGGGCAATGATGAGGTGACCCAAGTTTATGATTAATC
TAATACTGCCAAACAAATTTCCATTAAAAAGTGTAACTGTAGGGTCTTTCTTTCTCTTGA
AAGTATGTATTTTACTTCACCAAATGAGCACATTATGGTGAAGAACTGATTTAATCATTC
TTTAATGCTAAAGATCTTGCCTTTTGCTTCTGTGGGTAAGGAGAGAAGAGATTTATGTAA
GTAACAATTAGTGTTTACTGTTCTTGGATTGGGAGGTTGGTTCATGGGTGTCGCCTGAAT
TTATTAAAATAATAACTGGATATATTAATAAATAAAACTAGGTAACACCAATATGGACCA
GTGATGAGAACATCTTCAGAATTGGGATTTATGATTAGTCTGATTCAGTACTAGTAAAAT
TCAATACAAAAGATACAGGGTATTTCATTCATTTTCAGAGATGATTCAAATTCTATTTTA
TTTTTGCATGGTGATTCAGTTAAGTACCTCTCCATTGATAAAGATTTAGGCTATTAATTC
CTTGAGGGAGGAGCACATAGGAAGTTGGACAATATTGTTAGTGTTCTAGTTGTGCAGTAA
GATTATGATTCCTTGGTGATTTATTATACCATATTTGGCACTTGAAAAAGGGCCCAACCA
TGGACCAGTGAGTAGCATGGAGCTGACATGAAACAAGGATGTTGATTAATTTTTAAGTGC
AAAAAGTGCATATATGTATATATATGTATACAAACACACACATATATGTTGCAAAAAGTG
ACTTCATCTATTAGCTCCTTGGCCAATGGACATATATACAGTCATTAGTATTCACAGATG
TTGTTCTTGAGCTTTTTGATTCATGAGAATTGATTATACTATTATTAATGAATCAGTGAA
TAAAGAAATAATGCATAAAGTATGTCAAGTATAGCCAATCATTAGTATTCTGAGCTGTAA
GAATCAAAGATTTTGATTAGATTCTGTAACTCAGAGGTTTATTAAAAAAAAGAAACTAGT
TATTTCTTCTGTCAGAAAGGGGCTTACAGCAAAAGTTAGCAATAGCCAAAGATCTGATTC
TCAGTTCTTCATGCCTGTGAACCGTATGAGAAGTGAACCAATGCAAGAATAAAGATGTAG
AAATTAATGATGGCTAATTATGCAAGTCTGTAATGAAACAAGGATTATTACTAATTATTC
TTATTTTCTGAAGCACTGAGTTTCATAACATAAATAGATTGTCTCCCTTACTGTTTTCCA
TAAAAGACATATCTAATTTCATGAGAGTGCCTGTTGTAATTTTGGATTGATGTTGGGTTG
TCGGTTTTATTTAGAAAAGAAACAAATCATTTACATTAAAAGTAATTGTTCCAATAATTG
CCTAATTGAAAGAAGGCCAGGTGTGGGCTAATATTGAGAATATGATCATAGGTATTATTA
ATCCAATTCTGTTCACTGAACATTATTTAAAAAAACAAAAATGATCTAGCCATTTGTATT
TTTGAGCAGTGAGCATACAAACAGATATTAGTCAGTGTTCTTGTCCAGCATCTTGGCTTT
TATTCATTTTGATGTATTGTAAAAAGTGAATGTATAAATGAGTTTGTGTTTCAATTATTT
AAAAGAATATGGAGGATTGGCCAAAGTGTCATCAAACAAAAATAACAATTAACCCGTTTT
TATAGATGAAAAATAAAAGAAATCTACATGGATCCCACTTTAGACAAAGTGCATGTCAAC
AGTTGCATGAAATGGTATTTCACTTCTGGATTATTGTTTGGTTTTATTCTTTTTTTAAAA
AAAATGAATAAATGATCAAATTATTTTCGGGGTAATTAAATAAAAGAAAGAACACAAGTG
AGTCAGTAAATGCTTAAATTAAGGTAAATCTTGGATCACTGCTTCATGGCACACTCTCAG
AAATGCTCAAATACAGTGCCTTAAAAACGATTAATGAGGTTTGGGTGTTTATGTGGTTAG
GGAGTATACAGATGGATAGTTGTTAATGGTTACATTTATTACTCTTGTGTTGGGTGGATT
TAAGAGTTCATTATATTAAGAATTAAACAGTAAGTAAATTCATACATAAAAGGTATGGTT
ATTCTTGAGTCAATAATGAGAATGTGTTAGGAACCAAGGTTTATGATTAATCTAAAAGAA
TTTCTAAAAGAAGTGAAGTCTTTGCTGTTTCATTGTTTCTAAAGTGTGTGTTTTCCTTCA
CTCAATGAACATGCCACAGCTAATTATTCAATAACAATAAAGATATTGGTGTTTTGCCTC
TGTGGTTAAGGAGCTCAGAGACTGTTGTAGATAATAGTTAAAGTTCATGTCCTGGGTTTA
GGTGGCTTGTTCATCACTAAATTATGTTAGAAGAATAAACGGCTAATATATACATATATA
AAAAGCATACCATGCAAGAACCAATAATGGAAGTGAACCAAAGTTTATGATTAGTCCAAT
GCAGCCCAACTTAGGTCCATTACAAATGATGGAGGGCTTTTATTAATTTTCAGAGGTTTT
TAATATTGTATTTTATTTTGTGCCGTGGTTGATTTACACACATTTCTTTAATGTTAAAGA
TCAAGGCTATCCACTCCTAGGGAGAAGCAGATAGGAAAAGGAAGATAGTGTCAGTGTCCT
CACTGTGAGTTAAGATGGTGGTTCACAGTTGTTCATTCTATTGTATTATTATCTTTTGCT
GTGTAATGAATTACTGAACAATTTGATGGATTAAAACGACAATAAACATTTGTTATTTCT
CATGGTTTCTATGTGGCAGGAATCCAGGAGAGGCTTACTGGGGGCAGTTTTGGCTTAGGG
TTTCTTGTGAAGTTGCAGGCAAGATGTCAGGTGGAGTTGCAGTCATCTGAAAGCTTGACT
GTGCTAGAGTGTCTGCTTCACTTACATGGCTGGAAAGTTGGTGCTGATTGTGGGAAGACA
CGGTTTCTTCACAAATAGACTCTTCCTCAGGACTGCTTGAGTATCCTTACAACGTGGCAG
TTGGTCCCCTAGAGCAGTCAATCTAAGACAGAGAAATGTGGAACCCTCAATGTATTTTAT
AATCTAGCTCCAGAAGTCATACACCATCATTTCCACAGTATTCTATTGGTAATACAGGCA
GTCATGATTTAATATGGAAAGAAGCTACACAAGGCTATGCATACCAGGAGACATGGGCCT
TGGGAGCCATTTGGAGGCTGGCTACCTCATGTACTATCTTTAAAATATGGACAAATTAAA
TAAAAGAAAATCTGGATGAAATATTAATGTGAGATTGGTATGAAGCAAGGAAGTGTAGTT
AATTATTTGTACAATGCTTAGATCCATTCTAAAAAAATACAGTATCACTTCTATGGAAAA
TAAGCTTATAGATCTCAGTAATATTCAAGGATCTTGTTCTTAGATTTTTTTGATTTGTGT
CTATTGGCTTTGTTGTTAGTGACTCAGTGAGTGAAACAATAAACAAAGGTATGAATGAAT
GAATAAAAAAGGAATGCTAGGCCTAGACCAATGATGAGTATTCTGGGGTGTCTGAATCAA
TGATTTTGATTAAACCCTGTAACTCTGAGGTCCATTACAAGAGGAGACCTAGTTAATACC
TATATGGTAAATGATATTATAGTAGAAGTTAGAATTATTTGGGATTTTGTTCCTAGGCGG
TTGAAGTTCATAGGTGTGGATTGTATTACTATAGAAAAGATTTAGTAAATGAAAAATGAA
ACAAATATGTAAATAAAGGAAGACAAGTAGAGCCATATGTTGCCTAATTATGAGAATGTA
TAATGTATTTATTATTATTAACACACTTCTGAAGCACTCAGTTTCAACATAAATTGATTA
AATCTGATACCTATTTGGGTAAGGAATATATATACAGAGATAAGTACCTAGAAATCAGTA
TTGTTTGTCCTGCATTATTTAGATGATGCTGTTTCTTAATGAACACAAGAAAATATGATC
TAGTCTGGGAGTAATGAGCAAATGACAGGTGTTAACGCCATTCATATTTCTGATGCAGTC
TGTGTGTTCACAGATATTGATGATATCATGAGTGAATGTATACACAGGAGTGAAGGTATT
TAGTTATTTGAGGAAGGTAAAGCAGTGTTTCTTGACTTTGGCTCTATTGACATTTTGGGT
AATTCTCTATGGTGCAGGATTGTCTTCTATATTGTAGGATGTGTAGTAACTTCATTGGCT
TCTACTCAGTAGATGCCAATGTTGACCCTCCTCCCAGTGTGACAATCAAACATTTCTTCA
GACTTTGGCAAATTTCATCTGTGGGGGGCAACGTTGTCCCCAGTTGAGATGAGAACCACT
GAGGTACGACATGGACTGAAGAGGAGCATGTGTTAAAAAAGTGTGAATTATTTATCCTGT
AGTATCTTACTGATGTTCAGATAAAGAAAAAGCAAAACAAAAGACCTAAAACTAGGCTCT
TCCCCCATGGGGTCAGGTTCATGTGTATAGTTGCATTTAATTGTATTATAATTCTGGGTT
GTTGATGGGCTGATCATACTGTGTTTTATCTGAAAAAACAAATAATTGTTCATGAATACT
TACTAAATGAATAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved