Pongo_pygmaeus Locus Mono:269:SNORA48
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:269:SNORA48
Pongo_pygmaeus
Mono:269:SNORA48
16
SNORA48
1001..1120
2120
GTGTTGGGTGGTTGGAAGTGTAAGGAAGTGTAAACGGTGGGGGCAGAGGAGCAGTGCAG
GCCACAGCTTTGAGGTGGAAAGCAGGTCTGGCATGCTCCAGCAACTACTTGGTCAGCACA
GACGGGGCAAAAGGCAAGGAGTAGATGAATGCAGAGTAATGGGCTGCGCTGTGTGAGGCC
TGTGCTGGCTGAAGCCTCTGGAGACCCAGTGAGAATCCGATCCTTGTTGCCTGCTCTCCT
CGGCCTGTGGCTGCATCACTCCTACCTCCTGTCTGAAATCAAGGACCCTTGTGATTGCAC
TGAGGGACTTTCTGGACAACCCAGGATAACCTCCCCATCTCACAATCCTTACATCATAGA
TTCCAGGAGCAGGATGGGGGCATTTTGGAGAGGCATTTAGCCAACCACAGCCACTGAGGA
CTTGGGGGATAAGACTGGCAATATCCAATCCATATGTTGGAAAATGGATTCCTGGTGCTC
AGAAATGACCAATCTTTAGGAAGCAACGAGTTTCTGAAAAAAACAGAGACGGAGTTTCGC
TCTTGTCACCCAGGCGGTGTGCAGCGGTGCGATCTTGGCTCACTGCAACCTGTACCTCCT
CTGTTCAAGTGATTCTCCTGCCTAACCTCCTGAGTAGCTGGAGGAGCTAAACAAATTTTT
TTTTTTTTTTTTTTTTTTTTTTTTGGTATTTTTAGTAAAGACAGGGTTTCACGATGTTGA
CCAGGCTGGTCTCGAACTTCTGACCTCAGATGATCCGCCTGCCTCGCCTCCCAAAGTGCT
AGGATTACAGGTGTGAGCCACCATGGCTGGCCTCAAAAAATTTATATTTAAAAAATACCA
TTGCAGTGTACAAATGACTCATTTCAATGTATAAAAGACAAAGTCCTAAAGCCCCTCCCC
CCATGCTGAAATTGTGCTGCACAGATGTGGAACCTTGCCAAGGGGCAGCTCCATGATGTC
TTCTCTGTGGCCCCAAAACATTTAAGAGGATGTCACTCCACCCTGACCTGGGTAGAGTGG
CATCTGGTTGGTGGTGTCCATCTTGCATCAGTCAGGAACAAAGCAACCCCTTGTTCATCC
CAGCTTGGTTTCTGGCCTGTTCCCATGCCTTGGACAAACAAACAATGCTTAGGAGCCATT
GCCTTTCAAGAAGATTTCACACTTTCAGGCCCCCGAAGGAAGAGTTCCAAGGGTTCCTGA
GTTTTATGAGCTTACAGAGTGCATACATTTTAAGCACACAGCTTGACGATTTATTTTCAA
GGGTTAACAGTCAAGAAACTCAACAGAGACAGCTCTCTCTGGCTGGTGATTTCTGGGATG
TGGGGAGGAGTCTGTGTGTGACCCTCCTGCTTCTAGAAATTCAATCCCTAATTCCCATCC
CAGCTACAAGGGAAACTCTCTCCAGGGCAAATGAGGACTATGGTGTGGCATCCGAACTGG
CTCCAGTGCTCAGCCTTGCAGACCTCCCCTGTGGGGGCTGGGAGCTGCCAGTGGCTGAGG
TCTGAGTTAGCTGTTGGCTCAGACCCAGGTTCCCAAGTGGGGATGGGCTCCCTTTGTGAT
GTCAGCATCCTGCCCCCACTTACAGCCCCTTCACCCACCGCCTCACCTCCTTGTCCAGAG
AGACAGGCAACGTGGACCATGGGTTCCCGCTGTGCCAAGCTCAACACAGGCCACAGCCGG
CCACACCCAGGCCACAGCACGGGCCATGGCCGGGGCCACGAATCCTCCATGAAGAAGCTC
GTGGCCTGTGTGAGCCAGGATAACTTCTCCTTGTCATCAGAGGGCGAGGAAGAGGAGGAA
GAGGAGGAGGAGGAGAAAGAGGAACTGCCGGTGCAGGGCAAGCTGCTGCTGCTGTTGGAG
CCTGAGCGGCAGGAGGAGGGCCAGAAGGACAACGCTGAGGCCCAGCAGAGCCCCGAGCCC
AAGCAGACACACTCCTGACCCACAACGAAGGCCCAGGAAGGGACGCCCACTGCTGCTCTG
GTGACAGTGTTCAGAGAAGAGTCAATAAAAAGTCTCTGAAGAATCCTCCCTGTCTCTGGT
TTCCCCTCACCCTATCCCTTCTGGTCCCACGTGTACACATGTGTGAAGACATGTGTGTGT
GGGTGCATGTGGAGGGAGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved