Pongo_pygmaeus Locus Mono:61:SNORD30
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:61:SNORD30
Pongo_pygmaeus
Mono:61:SNORD30
X
SNORD30
1001..1070
2070
ACTCCAGCCTGGGTGACAGAGTGGGACTCCGTCTTAAAAAAAAAAAAAAAGAAAGAAAG
AAATTTATTGAGAGAAATACCTGTGATACGAAACGGGGAAGGAGCTGAAGGAATCTGGGA
AAACTGCCAAACCACAATGCAGAACTGGCTCTGGATGAAAGGGAAGGGTAAAGAAGGAAG
AATTAAATAAAGGTTGGGAGAGAAAGCATTCTAGACTTCATTGTGGTTTAAGAGACTTCT
GAAAGGTCGTTGGAGAGTCCTTGAGCCAAAATCCCCTAACAGAGCAGCCCTGCATGTCTT
AGGAATGGGCCTGTCTTAGAATCTCTGCTGTGCTCAATTGTTTACTGGCTAGAAGCAGCC
CTTAGGAAGAGTGGTCTGTGCACAGCACAAGTACTGTGATGGATTTCTAAGTGCTACAAT
TGGGCCGCAGGTCAGTTACACTCTCTTCCATCAGAGATATAAGAAGCACATTTTCATGGC
ACTATGCATGGTGTATTAGTCCATTCTCACACTGCTATGAAGAAATATCCGAAACTGGGT
AATTTATAAAGAAAAGAGGTTTAATTGACTTACAGTTCCACATTGCTGGGGAGGCCTCAG
GAAACTTACAATTATGGTGGAAGGCAAAAGAGAAGCAGGCACCTTCTTCACAGGGCAGCA
GGACGAAGTGAGTGCAAGCAGGGGAAATGCTGTATGCTTATAAAACCGTCAGATCTCATG
AGACTCTCTCATTATCATGAGAATAGCATGTGGGAAACAGTCCCCATGATCCCATTACCT
CCAGCTGCCCCCAACCTTGACATGTGCGGGTTATGGGGATTACAACTGAAGATGAGATTT
TGGGTGGGGACACAGGCAAACTATATCAAATGGCAACATATATTTATTTATATATTTGTA
GGTCATTTTAGCAATAGTTTTTACATTTGGAATGTTCATTTCCTTTCACATGGCAGTTCT
ACCTCTAAGAATTTATCCTTCAGAAATATACAACTGTATATATACATGATGACTTACATG
GACTCTCATTCAGCTAATGACTTGCTGCTGAAATGTGGAAATCTGACTTTTAAAAATATA
AAATAAGTAAAAATATAAATAAATAAAATAAAATAAATTTTTAAAATAATTACACGACTG
TAAAAATCTATGCAAAGTAATGATTATTGCATCATCATGTGTCATTGTTAAAAATTAGAA
ACAATTTAAAAGTTAATGGGGACTGGGAAAAAAATAACAGCATTGAATATGATATTGTTG
GCATATATATACATTGAAAGGAATACATGAGATAGTATTGAACAATAATGGATTACAAAT
AGGATGTCTCCTGTGAACTTTCATGTCTATGAAAAAGAAAGTAAACCAAGTAAGTGGAAT
AAAAGTGCTCATCTTTCTGAATATAAGCTGAAATTTTAGCTCAATATTTTGTCTCATAAA
GAAAATGAAACATAAAATTTTTCTCGTAGTAGAGAACTCTTCTTAATTACTTTCTTTTTT
TATTATTATTATACTTTAAGTTCTGGGGTACATGTGCAGAATGTCCAGGTTTGTTACATA
GGTATACACATGCCATGGTGGTTTGCTTCACTCATCAACCCACCATCTACATTAGGTATT
TCTCCTAATGCTATTTCTCCTCTAGCCCCCCACCCCCCGACAGGCCCCAGTGTGTGATGT
TCCCTTCCCTGTATCCATGTATTCTCATTGTTCAACTCCCACTTATGAGTGAGAACATGC
GGTGTTTGGTTTTCTGTTCTTGTGTTAGTTAGCTGAGAATGATGGTTTCCAGCTTCATCC
ATGTCCCTGCAAAGGACATGAACTCATCCTTTTTTATGGCTGCATAGTATTCCATGGTGT
ATATGTGACATATTTTCTTTAATTACTTTATTTTGAACAACTACTTGGAAAAAATACATA
AATCTAAAATGGCCTTAATCAATGTCAGTTTTGTATGTTAATAGAAATTATCAGCCAGAA
TTTATAAGAAAAAAAGGAAGACAAAAAATCAACACTAATTTTTATTTATTTATTTATTTA
TTTTGAGATGGAGTCTTGCCCTGTTGCCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved