Pongo_pygmaeus Locus Poly:7:SNORA40
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:7:SNORA40
Pongo_pygmaeus
Poly:7:SNORA40
12
SNORA40, SNORA40
1001..1128, 2056..2171
3171
AAATGGAAATTGTGCATCCTGAAGTACCTTGTTAAGAGTCCATTTTCAGCCTGAAATTC
CTTTTTTTTGTAAACCACTTCAGCAAATAAAGTGTTGGCATTTACATTAGCAACCTCCCA
GCCTAGGAGAGGATGCTCCAGCATCCGACTCTAAAAGACGAATTTGTCTGGGCACGGTGG
CTCACGCCTGTTATCCCAACACCTTGAGAGGCCGAGGCAGGCAGATTGCTTGAGCCCAGG
AGTTCAAGACCGGCCTGGGTAACATGGTGAACCCCCATCTCTACCAGTAATACAAAAATT
AGCCAGGCATGGTGGTGTGCCAGTGGTCCCAGCTACTTGAGTGGCTGAGGTGAAGGATCT
CCTGAGCCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATCGAACCACCGCACTCCAGCCTA
CGCAACAGAGCAAGACTGTGTCTCAAAAACCAATAAAAATAAAAGATTTTAAAAAGACAA
ATTATCCCACAAATGGTACATTGTGGTGGTGGTGGTGGTGGTGGTAGACCTCCCTCTGGT
TCTTGAAATTGGATCAAAACAAACTGACAATGCTACCTACTTCATGGGGCCATTGGAGAA
TTCACTGATAATGCATGCAGATCCCCTTCTGCCTGGCACACTACCTAATAAATAAACGGT
GGTTGTTATTGTTGGAATTGGAGGATATATTGAGCATCTCCTAGTTGCAAGGGTTTCACA
CGTATTACCAAGTTAATCCTCACAGCAGATATGATTCTGTTTTACAAAGGAAGCGGTGGA
TGCTCAGAGAGGTTAGGTAACGTGGGTCAGGGACACACAGCCAGGAAGGGGCAGAGGCTG
GGAGTGCCTGATTCCAAATTCATGCGATTTCTACCCCACTGTCTTCTCCCCAAGGAAAAT
AGTCCCTAATGCATGTGTGCAATGCTTAGAGGGCAGTAGATGCTCAACAGATGCTGAGAG
AGTGAGGAGTAAATGAGATATGCCATGAAAAGGAGCCCCTATGGACTTAGGTGTGCGTTT
GTTTAACTTGTGGGCAAGTACTTATAGACAGGTGCAAACAATAAATCTCCTTTTGCAACC
AAGAACTTGTTGTTCAGTATGAGTTTTGATACATATAAGAAAGGCTATTATGATATCTGA
GACAGTTAACTAAGGGAGGGAGTATTGATAACCATAAGTGTTAGTTGCAGGCTGGGCACA
GTGGCTCATGCCTGCAGTCCCCTCACTTTGGGAGGCTGAGGTGGGAGGATTGCTTGAAGC
CAGGAGTTCAAGACCAGCCTGGGCAAGAAAGCAACACCCCATCTCCACAAAACTTTAAAA
ATTAGCTGAGTGTGGGGGCATGTGCCTATAGTTGTAGCTACTCTAAAGAGGCAGGAGGAT
CACTTGAGCCCAGGAGTTGGAGGCTGCAATGAGCTTTGATGGCACCACTGTACTCCAGCC
TAGTCAACAAAGTAAAACCTGTCTCTTAAAAAAAAAAAAAAAGGTTATAGGACTGTAGAA
TCATTAGCTTAAAAGCATAGGATTTGAGGGAAAACCTCAGTTATATTAATTTTTTATTCC
AATTTCATGTTAACTTGATTTTTTATAAAGATCTTTTTTAAAAAGGAGCCCCTGCTTCAT
TTGACAAAGCTTGGAACGTTTGGGGACACCCAGGACTGCCTAAACCAAGTTCCACTGGGG
CTGGGGCCATGTCTCAGTCACTTCTGAGACTGGCAAGGGCCTGGCATACTGGGACTGAAC
CCCAGGTCGATGCCAGGCATTTGCTGTGAATCAAAGAAGCCTGAGTTTTTCAGAGTCCAG
AAGAATCTGGAAGGTCAACCAAGCCAAGCCCCTTTATAACATCCATTCATTCTGGCATTC
CTCTCTGGTTCATGGAGCCCCTGCTGTGGGCCAGGCACTGGGGAAGAGAAGAGGCAGTCT
GTGTCATCCCGGGAATCCTGACAGAAAGCCTTCTGTGAAAGAAAGAAAACTCACCACCTG
CTAACAGCAATGGGTTAGACAGGGAGGATTCAAGGCTATTTTGTTCCTTCTTTTGTCTAT
NNNNNNNNNNTAGGTGTGCGTTTGTTTAACTTGTGGGAAAGTACTTATAGACAGGTGCAA
ACAATAAATCTCCTTTTGCAACCAAGAACTTGTTGTTCAGTATGAGTTTTGATACATATA
AGAAAGGCTATTATGATATCTGAGACAGTTAACTAAGGGAGGGAGTATTGATAACCATAA
GTGTTAGTTGCAGGCTGGGCACAGTGGCTCATGCCTGCAGTCCCCTCACTTTGGGAGGCT
GAGGTGGGAGGATTGCTTGAAGCCAGGAGTTCAAGACCAGCCTGGGCAAGAAAGCAACAC
CCCATCTCCACAAAACTTTAAAAATTAGCTGGGTGTGGGGGCATGTGCCTATAGTTGTAG
CTACTCTAAAGAGGCAGGAGGATCGCTTGAGCCCAGGAGTTGGAGGCTGCAATGAGCTTT
GATGGCACCACTGTACTCCAGCCTAGTCAACAAAGTAAAACCTGTCTCTTAAAAAAAAAA
AAAAAAGGTTCTAGGACTGTAGAATCATTAGCTTAAAAGCATAGGATTTGAGGGAAAACC
TCAGTTATATTAATTTTGTATTCCAATTTCATGTTGACTTGATTTTTTATAAAGATCTTT
TTTAAAAAGGAGCCCCTGCTTCATTTGACAAAGCTTGGAACGTTTGGGGACACCCAGGAC
TGCCTAAACCAAGTTCCACTGGGGCTGGGGCCATGTCTCAGTCACTTCTGAGACTGCCAA
GGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved