Pongo_pygmaeus Locus Mono:216:SNORD87
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:216:SNORD87
Pongo_pygmaeus
Mono:216:SNORD87
8
SNORD87
1001..1089
2089
TGTGAATCATAATATTAAACTGAAACTTTTTTTGTTTCGGTTAATTTTTTTGAATTATT
CAAAACCAGTAGTTTATATTCCTAATATTGATTGTGTGAAATATTTTCAGCATTTCAGCA
CATGAAAATGATTGTTTTTGCAAGGTCCAACCTTGTATGTCTTCATTAATCATTTCGTAT
TGCTGCCTGGCTCGATTTATTCTCCTGGGGGTGCTGTATGACATGATTTTTTGCCCTAGT
CCATGTTCTTTGCAGTTTTTAGTTAACTTGGGACTTAATTTTACAAGAATGTGTCCAGTA
AAAATGCCAATATAGGTATCCTGCTCTAAAACTGCTAGGTTTGCCGTTATAATGTTTTTA
GGTGAAGGTCTTCACGTTAGTTTTTATACATCTAACCTGGCTCATAGCTCATCCTCGTCG
AGCTGTGAGACAGAAAAGCAGTGGCTGTGTGCTCACTATGACCATTATGTCTTAAAATCA
AAACTGCCACAGTGAAGGATATCATAAAATGTTTCCACCATTTTCCTGCCAGTGCTAATG
GCTCCTGTTTCCAGTTTGGAATAAGCTCATTTGTGGAATTACTAGGTGCTAATCAGACAA
ACATACTTAGTTACAGAGGTTTGGGTTTGTCAGTATTGACTATCAAAAAAGCAGAAACAG
GTAATAGAATAATAGTACTTTTTTATTAAAAAGTGGTTTGGGAGTCTGAAAGATAGGTTG
CAAGTACAGTTCCTAAAGGAATGAGATTCTCTTCTTGGACCATTCCTACAGATAAGATGC
CCAACAAAATGCAAATAAAAATGGGAATTTGAAATGTAATATTTAATTTCCAGGTGAAAG
AAAGCCTTTGAGGTGAAGATGTATGAAGGTCATCATAACAAATGTTTTCCAAAAACTTGC
AGAAGGCTGTGAAAACTACTAGGATCACGCGGCATGTATTGAGGTACCTAAATTTAATTA
ATGTTAGTTATGTGATGTATTCTTGACAGATAGGTTTAATAGCTGGCACAATGATGACTT
AAATTACTTTTTGCCGTTTACCCAGCTGAGGGTGTCTTTGAAGAAATAATTTTAAGACTG
AGATGCCAGTAATGTACATTGATTAATTACTGACATGTATGTAAGGCAATAATTTAATTA
AGGGTGAATATTCTTTCTTTTTAGCATATAGGTTGCTGTAGATGAATGTTCTTAGCTGTC
ATGTTTAAAAATACTTCTTCGTTACCTCAAGTAAGTGATTTGTCAAGCAACTATGTCTGC
TGACAGTTCAGAAAGTATCTGATAAACGTCAAAGGGTGGGGGCAGATTCTTGTTGAAGTT
GCTTTTGCATGTGTGGTATTCTCAACATTAATTTTTTGAGGGGCACTTGTGAATATTGAG
GTTATATGAGAACTTTGAGTATGGAATGATTTTCACTGTGGTTTCTGACTTTGTTTTGGA
GGTGTGGCATGCAGCATTTTGGAAGGAAAATTGAAGACTTGTTCAAGAAAACATGAACAG
AAGCAAATGATGAAAATGAGCATTTTACTTGATGTTGATAACATCACAATAAATTATGGA
GAAAAATACATATTTGGCTAACTTTTAATTGCTGAACAATAAAGTATTTTCTTTTAAATC
AACTCTAAATAGCTCCATTCTCATAGTCACTACTCAGACCTGTTTTGAACATATTCGAAA
GATTATAATCTTGTCAATAATTAGCTTATTTATGGGTGGTGATTCTCATTGAGGCTGACA
GCTGGGGAGATACTGCTTGTACCTCTAGGTTCCCTGTCTGGCTTCCGCTTCAGAGCCTGC
TGTTGTACCAGGTGGTTGGAATCTTAAAACTCTAATAACAAATAGCAATCAAATTCCTCC
TTACAGATAAAGGTTTCACCTTTTTTATTCAGTTTACTTTCATCTTGTGAACAAAAAAGT
CATCCTAATCCTAGTACATGTAATAACTAAGCAATATGCTATGTTAAATGACTGAGCAGA
CCAGTCTGTCTAGGACTAAATTGGCAAGAATTCTAAAGCTGAATTTATATCTGGGTGAAG
GTTTAGAGCTAAATCTTTTCTCCTGTTGAGTACTAGCTTATAAATTCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved