Pongo_pygmaeus Locus Mono:21:SNORA26
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:21:SNORA26
Pongo_pygmaeus
Mono:21:SNORA26
7
SNORA26
1001..1110
2110
GGAGCTTATTTTCCATTCTGGTTCCATGTGAGCGCTCAACATTGGGCAGAGTTTTTGAG
TCATTCCTATATAGGCTCTATTGTTTTGAATATCTCTCAGAGATAGAAGATGAGAATGTA
GTGGCATATGTTTGAATATAGGAATGAGAAAGATTTCCCCCATCGTGTGGCTCTGAGACA
CCACGTGTGGGGGAGGCTCAAGTGTGCCGTGGGAGGGGAGGGGTTTGGTCATTAACCCGC
TCCTTCTCCAGGATTCGACTGCCCTCCCACGTGGCTGGCTGCAGAGCCCGTAATGAAGCT
GACAGCTTCTTCCAGGCACGATTTTTCTTTCTTAAAGCATGGCTTCTTCGGAACAGAACC
AATCAGAGTTTTATTTTATTCCATTTCTATGAACTGGTTGTGGGATGAAGCTTCTTTGGT
GTGGGAGAAAAAGTGCCTGGATGAGGGATTGATGAAGAGCAGAGCAAGCACGTTACCACC
AAGTATGTGTCTTGGTGATAATTCAGTTGCAACCTTAGTGAGGACATACTCTGTGTTCAG
CATTGTGGAAGATTCAAAATGAGTAGGAAAGGTCATTCTTGCTGTCCCAAAGCTTCCAGT
CCAGTTGAGGAGATAAGATAGGGGACCGGGAGGCAGTGGTGGGCATCTCTGATTCACCCA
CAGAGGGGATGAGGCTGAAGGTTGGAGAGAGTGAGGCAATAATGGAAGGAAAGACATCAA
AAGCATATTTTAGACTGTGGTTCCTTTGGGGCAGAAAGGAAGAAGTTTAAGATGGGTGCG
GATGTATTTACATTTATAGGATACTGATACCAGACTGAATTTAATACAGGTTCACTGTCT
CCTTAAACATAATAAGCTGGACAAGAAGCAATGACAATCTGTTAACAAGGAACATCGTAA
TTCAAAGTTCTACTGAAAGGAACATGGCACCTTGGAAAACAATTATTCTGAGCACGGGAG
AGAAAAATGTCAAAGACTAGCAGGGCAACTCAGAAGGGCACATGACCCTTTCCTGCGCCA
GAGGCTAACACAGAAGGGTAAAGCCAGTCTCCTTAAAACCCAAAGAAGAGATTGTAAAAC
TTCTCTTTGGATCCTGTCTGGAGTCACAGCTGGAAAAAAAAGGAGCAGGGGTCCTAACAG
AGCAAATTTGAAAAGGCTATTGTTGTTTATTTTATTATTTTATTATTATTATTATTTTTG
AGACAGAGTCTCATTCTGTTGTCCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGC
AACCTCCGCTTCCTGGGTTCAAGTGATTCTCCTGCCTCGGCCTCTCGAGTAGATGGAACT
ATGGGAGTGCACGCCACCATGCCCCACTAATTTTTTTGTGTTTTTAGTAGAGAGGGGCTT
TTGTCATGTTGCTCAGCCTGGTGGTCAAACTACTGGCCTCAAGTGATCTGCCCACCTCCC
CCTCCGAAAGTGCTGGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
TCCTGTCTGGAGTCACAGCTGGAAAAAAAAGGAGCAGGGGTCCTAACAAAACAAATTTGA
AAAGGCTATTGTTTTTTATTTTATTATTTTATTATTATTATTATTTTTGAGACAGAGTCT
CATTCTGTTGTCCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAACCTCCGCTT
CCTGGGTTCAAGTGATTCTCCTGCCTCGGCCTCTCGAGTAGATGGAACTATGGGTGTGCA
CGCCACCATGCCCCACTAATTTTTTTGTGTTTTTAGTAGAGAGGGGCTTTTGTCATGTTG
CTCAGCCTGGTCTCAAACTACTGGCCTCAAGTGATCTGCCCACCTCAGCCTCCCAAAGTG
CTGGGATTACAGGTGCGAGCCATCATGCCTGGTGGAAAAGGCTATTATTGGTTAAACTTG
GGATAACTTTAGCTTCAGAAAGTAGGACTGCAAAGATTGAAACACATCAAACATACAAAA
ATCCATGAGTTCATAATGATATTCCAAAAATATTTTCATAGTTAAAGGTGTTTAAGGAAG
CAACTCATTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved