Pongo_pygmaeus Locus Poly:4:SNORA73
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:4:SNORA73
Pongo_pygmaeus
Poly:4:SNORA73
1
SNORA73, SNORA73
1001..1205, 2163..2366
3366
TTCTTAGTGGAGACAGGGTTTCGCTCTGTTGGTCAGGCTGGTTTTGAACTCCTGACCTC
CGGTGATCCACCGCCCTCGGCCTTCCAAAGTGCTGGGATTACAGGCGTGAGCCACAGCGC
CTGGCCGGAAATTATATAATTTAAAACTATATACGGGTGTCTTAGGCGGCATCCGTCCCA
ACTAAAGTACGCGTTAGACGGGCCTGGGCCAGAAGTGGGCCATGGAGACCTCGGGACCCG
CAGGGCTGCCGCCCGACCCGCCGAGTCTTTGAAGGTGCACCGCCACCCCCACTGTTTATC
TTACTGCCTCATAGTAGGCACATTGTCATTCTCAATGGAATTGCACACAGTTTTATTCTG
GATCCTAATTTGCCTTTAAGAATTTCCTCAATTTTTCTTTATTTGATCGCACCACTGCAA
CCTCCGCCTGCTGGGCTCAAGCAATTCTCCTGCCGCAGCCTCCCGAGTAGCTGGGACTAC
AGGCGTGTACCACCACGCCCGGCTTATTTTTGTATTTTTAGTAGAGACGGGATTTCACCA
TGTTGGCCAGGCTGGTCTCCAACTCCTGACCTTGTGGTCCGCCACGCCAGGCCGAAGATT
TTCATAATTTGGAAGCATTACGTTTCGTAATTCTCCTTTCTCGTATTTTTGTGATTTGGA
TCATTTTTATTTTTATATTTTTAGGATTACAGGAGTGAGCCATCGTGCCTGGCCAATTTG
GGGGTAATTAACAAGTCCACGTGTTTCATTTGAATTTAGGATAGCTGGGCCTAATTGTTG
TCTTTACTTCTGCCGTACCTTCCGCATAGGACTAACCGCCTATTGTAAAGTAATTAGAAT
AGCTGAATATGCATGTTACCAGTCTAGAAACCGATTTTTTTAACACCCCGCTCTTGACAG
GGTGGAAACTCGTTTGCTTTCTTGTTTAAGATCTGTAGTAACATGAATGGATGATATTGT
TTCCTATTAGATTCTGTAAATTTATGCGTTATACTGATTGTCCAACGTGGATATACCCGG
GAGGTCACTCTCCCCGGGCTCTGTCCAAGTGGCGTAGGGGAGCATAGGGGTCTGCCCCAT
GATGTACAGTCCCTTTCCACAACGTTGGAGATAAAGCTGGGCCTTGAGTCTGCGCCTGCA
TATTCCTACAGCTTCCCAGAGTCCTGTGGACAATTACTGGGGAGACAAACCATGCAGGAA
ACAGCCTTCTAGAGCACTGAATCTGGATTGAAGTCTGTCTTTTTTTTTTTTTTTTTTGGA
GATGGAGTCTCTCTGTTGCCCAGGCTGGAGTGCAGTGGCGCACTCCACTGCAGCCTCCGC
CTCCCGGGTTCAAGTGATTCTGCTAAGTGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGG
GATTACAGGCCCCGGCCACCACACCCGGCTAATTTTTGTATTTTTAGTAGAGACAGGGTT
TCACCATGTTGGTCCTCGTGATCCGCCAGCCTTTGGCCTCCCAAAGTGCTGGGATTACAG
GCATGAGCCACCGCACCTGGCTGGATTGAAGTCTTAATACATGTTTAAGAAAAATTGGCT
AAAAAGTAGCCAGGCATGATGATAGGTAGCTGGAGGAAGGAGAATCGCTGGAGCCCAGGA
GTGACCTATGATTGTGCCACTGTACTCCAACCCCAGGTGATAGCATGAGGCCCCTCATTG
AAAAAGTTCAGGGTTTTGCTGTACTAATAGATTAATATGTTGTTTTGCAGGATTTGTTAA
GGATTCCAAGTAACTCTTATTTGGTAAGTAAATCTGCTAATTGTTTTTTGCTTATCAGCT
CTTTGTCAATGATTTCTGTACTGGAAATAGGATTGAAGAGACTTTTATTCTAGTTGGTCA
GGATTTACCTCTGAGGCATTTAATCATTATCAGAGCAATAGCCAAATACCAACTTTGCTG
CATTTTTGTAGGCATGTTGACATAACTTCAACATACGCTCTGTTCTGTAAAAATTGCTTT
TTTTAGTCGGCTCATTAAAAGTGTGCAATGTAGTAAAAGTTGGCCGAGTGAACTGTAGGA
AGCCTAATTGGCTTTATCTACATGTGTAGCCTGAGCTGAGAAAGATACTAGCCCTTGAAA
ATACTGTGGGTGATTAGCAATATTGGATTTGTCAGTTACTCCAATTCCTCATTAATGAGC
ATTCCAACGTGGATACCCTGGGAGGTCACTCTCCCCAGGCTCTGTCCAAGTGGCATAGGG
GAGCTTAGGGCTTTGCCCCATGATGTACAGTCCCTTTCCACAACGTTGAAGATGAAGCTG
GGCCTCGTGTCTGCGCCTGCATATTCCTACAGCTTCCCAGAGTCCTGTGGACAATGACTG
GGGAGACAAACCATGCAGGAAACATGTCTAGTGTNNNNNNNNNNATGTCTAGTGTACTAG
ATTTCACGTTGAAGTAGGATCTTCGGGGGTGTCAGTAAAAATTTCTTTTCTTTTAGGAAA
GAAGACGATCTGCATCTTAAAAAATATGGCATTGACATTTAATTTTAGGGTCCTTTATAT
AGAAAGGAGAGTAGGTAAACTGATTTTTTTTAACAGGGAGGGTCTGACGATCTTTGGCAG
ACTTGGAGCAAAAGATTGAGGTGCATTGCATGCCTCCTTTTGAGAGTCTTGCTCTGTTGC
TCAGGCTGTAGTGCAGTGGTGCGATCTTGGCTGCAACCTCAGCCTCCCAAGTAGCTGGGA
TTACAAATGTAAGCTACCACACCCAGCCCTCATACCTCTTTTAAAAGTCACCCCGTTTTG
CAGAAAGTCTGCTGTTTTGTACTGAAGGCTTTGGAATTTGGCATTTAGCTAGGAATGCAC
GTTCTTTCACCTCATTCACACTTTAAGAACCACAGAAGTGACTCTGCTTGGCCAGAAGGC
ACACAGTGTTGGTGGGTATATTAAAAGTCCTTGAGTATTTTGCTTTTGTGTTTTTATTTT
TTTTGAGACGGAGCCTCGTTTGTCTCCCAGGCTGGAGTGCAGTGGCATGATCTCGCTCAC
TGCAACCTCTGCCTCCCAGGTTCAGGAGATTCTCCTGCCTCAGCCTCCTAGTAGCTGGGA
CTTATAGGCGTGTAGCACCACACCTGGCTGATTTTTGTATTTTTAGTAGAGAGGTTTCAC
CGTATTGGTCAGGCTGGTCTCAACTCCTGACCTCGTGATCTGCCCGCTTCGGCCTCCTAA
AGTGCTGGGATTACAGGCGTGAGCCACCCTTCCCGGCCACTTTTGAATGATCTCTAATGT
ATTTGTAATTTACCTAACATTGCCTAATCTGCTATGTTAATGTATTTATGAATTAAAATA
AATGACTATACATGTTTGTGGTTCATTTTTGTGGAGATGGCTGTGGTGACATCAGCCAAG
AATCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved