Pongo_pygmaeus Locus Mono:206:SNORA62
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:206:SNORA62
Pongo_pygmaeus
Mono:206:SNORA62
8
SNORA62
1001..1155
2155
CCTCAAGATGGGGTTTACAGTGCAGGAATGAGGAGGAGCCAATGGCAGGTATAGAATGT
TCCCACACCTCAACCACTGCCAGGCTCCGCAGCTCACTGATGCGCCAGACGCTGCTTCAG
AGCACCGCTTCATTGGTACCACTTCTGAGAAGCAGCAAAGCAGACATGCTTCTTTCTTTA
TCATCTTCTCTATCTCTCAATGACGACTCATTCTCTCTTTCAACCTCTCTCTCTTCCTCT
CTCCTACCCTCTACCCTCATTCCCACCCCCTTATCACTACACTAAGGCCAGCAAGAGGCC
ACAACCACAGAAGAGCTTCCAGGCAGCAGCGAAGCAGTTCAGTCTCAAAGAAAGCCAGAC
AGGAGTCCAAATGCCTGTGTTCCTTCTGGAGTTCGCTATACGACCTCACTATAATCCCTT
CACCACTGTGGGCTTATTTTCTCATCTGGAGGACGAATGGGTAAGAAGAGACTTCTGAGG
TCTTTTTCCTGCTTTGAAATTCTGTGATTTCACAATAACTGAATACAGTCACTAAATGGG
AAACCACCAGGACACTGGGGGGCAGCCATCACATAGCCATCTTTGTTGTATTTTTCATTG
CAGGCTTCCAAAATGTCTGTTGCCAAGAAGTATATCCAACTAGACCCTCGGCCCATGTTT
TAATTTTTACACACTGTAATTAAAAGCAGAATGACTTGCTTTTACTTTGGATTATGTAAT
TTCTTTCTATTCATAATGAGCAGCTCTTACATGATGCCAAGTGAGTTTTCTCTTAGGCAG
CACATTCTTACTCAACCAGAGAACTGTTGGCATTTGGATTAATAGAATCAATAGTATCTT
TCATTCCAAAACCAGAAATTGCTGTTTTGATATGGTCTGCCCAACAGTTCTTCCAAGGAA
AATATTTTTATTATTTTACTACTAATATCTCATTACAGCTTATACATGAGTGAAGCATTT
ATTTTTATATTAAATAAATCATGCTCTTTAAAATAAAAATGAATATATTCTTGTTAGAGC
TCGGAGTTGAGGCCACTGACTGGCCAATGAACTCACAAGTGTAGACAGGGTGCTACGCAA
GGGACAAGTTTTTCACTAACACCACAAGCGTCTCTGGCCCAATGAGTGGAGTTTAATAGA
AATTCTTGCTACAACTAAAAGAAAGAAAAGAAGAAATAAAAGAATATACTCTCCTACTGT
AAAATCCACTTAAGCAAAAGTAGGTTATCAGGTCTTTATTGCAGAAAGTGGCTTTTATTT
CTTCTCTGCTGTGGAAACAAACCTCCAAATCATTGAAAGGTGGAACAGTATCCTTCTACA
GAAATCGGATTTAATCTTGACAGAATTAAATAAGAATCACTCATTATACACTGATCTATG
TTTTAGCAATTATACACTGATCTACGTTTTAGCAGATATTATGGAAAACACAAAGGTGTA
ACAGGTTCTCTGCCCTGCAAAGAGTTTACAATCTCATATGGAAATCAAATGTATACACAT
GATAAATGCTACTTAAAGACCTACTGCTTGCAAAACACCATGGAAGGCACGAGGTATGTG
AGTGAGACTCCACCTCTGCCAAAAAGTTCCTCACAAGCTGGTGGGAAAGCCAGACCTGAG
TAATCCAGACACTGCTAACCTCCCAAGACCACCTCCGCTGCACTTAGAGTGGGAAGTCCA
GTGGCTTTCCTAGAAATGTGGTGGCTTCCAGGGTAGACAGACAGGGAAGGAGATGGAGGT
AGCTTATCTTATGGTCACCTCTTGTCATTTCTCATCTCCTGGAGGTACTCCCTCTCTGTC
AGGTGAAAGTAGCACCTAGTTGGGTGGGTTGGTTGGTTGGTTCGTTGGTTGGTTGGTTGG
TTGGTTGGTTGGTTGGGTTTTATCAGTCTGACAATCTTTATCTTTTAATTGGTACATTTA
GAACATACACATTTAATATAATTACAAATACATTAGGGTTTACATCTACCATTTTATTTG
TGCTACTCATCTCATCTATTTTATCTTTCTCTCCTTTCTTGCATTCTTTTGATTTAGTTT
TGTTTTTATTTTTCCCTCTCTCCCTCCACACATGCGCAAGTTTAGATGCTATACACTGCT
TTTAGGCTTTCATTATCCTAGAAATTACAATAAATATATCCAACTGATCAAAGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved