Pongo_pygmaeus Locus Mono:76:SNORA75
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:76:SNORA75
Pongo_pygmaeus
Mono:76:SNORA75
12
SNORA75
1001..1125
2125
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCACGATGCTCTTCCGGTTTAAGGGCAATTAAAATGACTACAGA
TTGGTGGCAGTTTATGGATTTGCACAAGAAGAGAGAACTCACAGAACTAGCACTATTTCA
CCCTCTGTCTTTACAGAGGTGTATTTGGCTGTTTTGTTAGACATTCTGGGGACAAGAAAA
AATGAAAAAAGAAAAACATGACTACAGAGGTAGAGGAATTACTACAAGAAGGGTAATTAC
AAAACATGACGACAATTCAATCCTGAGAGAGGGGTATGTACTGAAAAAGCTTTAACACAT
GAAGGAAAGGGGAAGAAAGGTACCTAACAAATTTTGAGTACCTCCTATGTGTTAAACACT
CTACAGTGGTCTTTTGCTTTTATTATCTCATTTAATCTGTACAACACTATAAGGATACAG
CTACTGGATACTGATGCTTACAGAAATTAAATAATTGCTCAAAGTCACAGCTAAAAAGTG
GAAAACCAGGGATTCGAATCCAGGTCCAAATGACTGTGCTTTAGTGAAGCTCATCCGGTT
GCAAGAGATATCCAGCATAAGTAAAGGGAGGTTCACTGAAGGGAGGTTCATAAACTGAGA
GTAAGAATTGAAACTATCTGGGAAAGCCAAAAACAAAAGCACACTAGAACTGCAAGGTAG
CTCGGACTTCAAGACAGCTCCAGGAACGTCACCAGCAAACACACACCCATGGGGTTCACT
CTCCTGCTCAGCCAGGTGTCGGATACAGCCACAATCTCACTCCCTCAGCACACTCGGTTT
CTGCTTATCCCAAACTTTCGCTTACACATGGCCTCATCAGCCCCTGGACCTTTCAGCTTC
AGCTCCCACTGCCAAGTAAAAAGTCTTCATGTCTCCTCGTTCTGAATCCCAAGAGAAAAA
GCTGACCAGCAGCTCCTCTCAAGACAGAGCACTGGTCAGCCTGAGACTGGTCAGGCTCCC
AGTCTCATCTACTCAGCTCGGGCCTTGCACTTGCTGCTTCCCCTTGGCCTGGAGAAGGAG
TCCTCAATATCCAGGCTTTGGCTCACCTCCTCAGAGAAGCCTCTCCAGCTGTCTGGCAGC
TGGACAGTGGTCAAACACCACCCCCACTCCTCACCCCCTAGCTTGCTCTAAGTCACTTTT
TAAAAATCACATTACTCTGTATTTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved