Pongo_pygmaeus Locus Mono:159:SNORA11
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:159:SNORA11
Pongo_pygmaeus
Mono:159:SNORA11
15
SNORA11
1001..1128
2128
CTAACGTTCAGAACTACCAATAACAGAAAGAAGATAATTTTTTTTTTTTTTGAGAATGA
AATGTTTCCCATCATAGTGGATTCTTAAGCACATTCTCCACGTGTGCGGAGTGCTAGCTG
GATATCTTTTGGCATAATTGTTATATGCTTGGCATGGATAGCACACAGGTTGGTGTTTTC
AAAAAGGCCAACAAGATAGGCCTTACTTGCCTCCTGCAAAGCACCGATAGCTCTGGAAGC
ACAAATCTGTTTTAAAGTCCTGAGCAATTTCTCTCACCAGACGCGGGAACGGGAGTTTGC
GAATTAGTTCAGTGGACTTCTGATAACGCCTAATTTCACGGAGTGCCACAGTACCAGGCC
TATAAAGACGAGGTTTCTTCACCCCTCCAGTAGAGGGCGCAGTCTTGCGACCGGCTTTTG
TAGCCAGTTGCTTCCTGGTGCTTTACCACCGTACAGTTTGCGGGCAGTTAGCTTTGTACG
AGCCAAGATATAGAGACTTCCTTACTTACTCCCTTCTCCTTCGACTGGAGCTCGGCGAGG
GAGAGGCGGGAGAGGCGGTGCTGGCGTTGGAGAGCGACGGCGGCGCGGCGGCGACGGCGG
CTGCAAACACAACTCTATAATTTCTTTTTTCTTTTTTGAGACGGTGTCTCGCCAGCACAA
CTCGATAATTTCTTTTTTCTTTTTTGAGATGGTGTCTCGCGCTGTCACCAGGCTGGAGTG
CAGTGGCGCGATCGCGGCTCACTGCAACCTCTGCCTCCACCTCCCAGGTTCAAGCGATTC
TCCTGCCTCAGGCTCCCAAGTAGCTGGGACTACAGGCGCTCGCCACTACACCCAGGTAGT
TTTTTTATTTTTGTAGTAGAGACGGGGTTTCACCATGTGGGCTAGGATGGTCTCGATCTC
CTGACCTCATGATCCGCCCGCCTCGGCCTCCCGAAGTGCTGGGATTACAGGCGTGAGCCA
CCCCGCCTGGCCTCGATAATTTCTTAATAGTAAAGAGGTAAGGGATGTGCTCAGAGCAGG
GGGCCTGAGGAATGGCTCCTCTGTTTACAACACACCCAACAGGAATCTGGGATCACTGTG
GCGAGAGGTACCAAAACTTGTAGGCTTCCTATGAACAAACTCTACATGTGAAGGGAAAGA
ATAATAATAACGTCAATTCATTAGATAATGCGACAGTTTTAAATTGTATACATCTAACGT
CAGAGCTCCAAAATACATGGAAGCAAAAACTGACAAAGTTGAGAGAGACAAAACCACCAC
AATTAGATTTTTCAACATCTCAATCATTGATAGATCAAGTAGAAAGAAAATCAGTAAGGA
TTTAGAAAACTTGAATAACACTATAAAACATCTTGACCTAATTGACATTTATAGACATTT
CATCCAGCAACAGCAGAATACATATGTTTTTCAAGTCCCCTCAGAACATTTACCAAGATA
ACCTGTATTCTGAGTCATAAAACAAGTCTGGATAAAAGATTGAGATTATACAATGTTCTC
TAATAGCAACAGAATTAATTTAGAAATCAAGAACAGAAAGATATCTGGAAATTATCTAAA
AACGCCATTTATAGTAGCATAAAAATATTGAACACTTAGGGATAAATTTGGAAAAAGATG
TCAAATTAAAGAAGATCCAAGTAAATAGAAAGATGTGCCATTTGCATGGATTGCCAGACT
CAATATTGTTGCATGTCAATTCCTCCACACATTGATTTAGTCATGCAATGCCATTCCAAT
CAAAATCTCAGCAAGTTTTCTTATAAAAATTGACAAGCTGATTCTAAAATGTATGTGGAG
ATTTTTTAAAAGGCCAAATAATTTTTAAAATAAAAAATAAAGTTGGAGAAATAATACTAC
CTAATTTGATTGACAATATAAATCTACAGAAACTAAGACAATGTTGTTTTGGCATAAAAA
TAAACATTTAGATCAATGGAACAAAAAGAGAGTCCAGAAATAGACTCACACATACATAGT
CAATTGATTTATTTTTATTTTTTATTTTTATTTTTTTAAGATGGGGTCTCACTCTGTCAC
CCAGCCCAGAGTACAGTGGGGTGATCTCGGCTCACTGCAAACTCCACCTCCCCAGCTCAA
GCGATCCTCCCACCTCAGCCCCCTGAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved