Pongo_pygmaeus Locus Mono:369:SNORA73
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:369:SNORA73
Pongo_pygmaeus
Mono:369:SNORA73
18_random
SNORA73
1001..1205
2205
GTAGGACAGTGGTTAGAATCGTAAGCTGCTTGTAGTTTAGATAATTTACAGCATCCAGG
AATTGGTTGCTGGATTGGATAGATCTCAGAGAAGAAATAAAGAAGAACAGTAGTAGTGGG
AATGAGGGCTTGAGAAGAACTGAAAGAACAGATTTTGTTCAGCTAGATAGTTATTAGAAA
CTAAGGTTTTTGAAGTACAGCTGTTTTGGAACTGTTGGGATCTGGAGTATGTCCTTGTAA
GTGGGAGGCAGGATTGGAGGATGAGGGAAGAATTGGGGAGGTGTTAATCTGTAAAGAGAG
GTGATTTATACCTGCTGACGTTTTTTGTCTGAAATGGGAGACAAGTTCATCTGTTGAGAG
TGAGTTTGGGGTGGCAGGTAGGGAGAGTAATTGAGAAGAGTGATAAGGACTTGGGGACCT
GCAGAAGGGTGTTCCAATCATGTTAGAAGCCCGTTTCAGGTTGAACACTACAGATCTTTA
GTGCCACCAGATACAGGAGTAGAAGGTAGATGGTAGATGGTTGGATTGAACTTGGGTTAG
GAATTTTTTTTTTTTTTTTTGAGACAGGGTCTTGCTCTGTTGCCCAGGCTGGAATTCAGT
GCCGTGATCATGGCTCATTGCAGTCTTGACCTTCAGGGCCCACCTCAGCCTCCTGAGTAG
CTGGGACTACAGGTGTGAGCTGCCATGCCTGGCTAATTTTTTGTAGAAATGCCCAGGTTG
GTCTCAAACTTCTGGGCTCAAGCAGTCTTCCTGCTCCCCCCTCCCAAAGTCCTGGGATTA
CCGGTGTGAGCCACCATGCCTGGCAGGAATTCTTTATGTAGGTGGATGAATATATTCCTG
GGATTAGCAAACATTTTCTGTAATGGGCACAAATAGTGGCTTATTGGCTTTTGCCACAGC
TGTCTAACTCTCATTGCAGAATGAAAGCAGCCGTAGATAATACATAAATGAATGGGTGTG
GCTGTGTTCCAATAAAACTTAATTTACAAAAACAGGTGGCTCCAATGGGTAATATCCTGG
GATATCATTTTTTCTAGGCTCTGTCCACATGGCATAGGGGAGCATAGGGCTCTGCCCCAT
GATGTACAGTCCCTTTCCACAGCATTGGAGATGAAGCTGGGTCTGGTGTTTGCACTATCA
TATTCCTGTAGCTTCTCAGAATCCTGTGGACAATGACTGGGGAGACAAACCATGCAGGAA
ATATGTCTAGTAAAAAAGAATAAAACAAACAAAAAACAAGTGGCAAACTGGATTTGGGAA
CTGTAGTATATGCTGTAGGCCAGGTTATATATGACTTTACTGAGAATAGCATCTGTGAAA
CTATGAAAAGAATGAAATCTAAATTATTCATGTATGTACATGACTGCTAATGAATAAAAA
CTTAGTGCTAAGTCAATTGATAAATGTAAAAAGTAGTCAGCTTGAAAAAATGGTAGACTG
ATATTGCTAAATTTTAATTTACAATTGTTTTACCTTTGGCTAACTAGCCACTTTCCTGCC
CTTTGAAAATGCTTAGATTAGTGTTCCTCACCTGTGACTGCACAATATATTCATCTGTGG
AGCTTTGAAAAATTACTAATGCCTCACTCTCACCTCTAGAGATTTAGTATGGTGAACGGC
CTGGACATCAGATTTTTTTTTCTCTCTTTTTCTTTTGATCTGTACAACAGATTTTAAAAG
ATCTCCCCAGCAGGTTCTAATGAGCAGCCAAGGTCGAAAACCGCCGACTTTCAATTCATT
GTTATGGTGTAGGTTTGGTATGGAATTTCAGGGTATGACAATTAAGGCCATTTTAAACTT
ATTAAATTTGAGGGGCAGCTTTTTCACTTCATTCGTTTTTGTCATTGGTTATATTTGAGG
CTACTTCTTTTCTTTTCTTTTTTCTTTGTAAAGCTTCAGCATGTGCCAGGAGTGGTCGCT
CATGCCTGTAATCCCAGCACTTTGAGAGGCTCATGTGGGAGGATCACTTGAGCACAGGAG
TTCAAGACCAGCATGGGCAACATACTGAGACCCCCATCTCTACAAAAAAAAACTTTGCCC
GGCAAGGTGGCTCACGCCTGTAATCCCAGCACTGTGGGAGGCTGAGGTGGGCAGATCACG
AGGTCAGGAGTCTGAGACCAGCCTGGCCAACGTGGTGAAACCCTGTCTCTACTAAAAATA
AAAAAATTAGCCGGGCGTGGTGGTGGGTGCCTGTAATCCCAGTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved