Pongo_pygmaeus Locus Poly:1:SNORA51
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:1:SNORA51
Pongo_pygmaeus
Poly:1:SNORA51
1
SNORA51, SNORA51
1001..1125, 4584..4708
5708
CTGAGCCCCAAGAGCAGCTATGATTTTTGTTTTTAAGAATGGACATTTCACATCTGTGC
AATACTGAAGACCTCACTTTGTCATCTTGCCCCAGTGACATAGTGAGAGGTCACCAGGCT
TGCAAATGAACTTCACACAGACCTCAGGGTAGGTTCTCAGGATTGAAGGAAGGCCAAGCA
ATTACAGGAGCACAGCATGTGCTGACTACTGTACTTCCAGACCCCCTGCCCTCGCAGGAC
TGCCCAGTCCTTGCACCTCAAAGTTCACCTTTTCATTTCAAGCATAAGGCAATAAATACC
TGCAGCAACATGGGAGAAAGAAGTTGCTGGACCAGCAGAAATGGCACTTATGAAGCCAAT
TCATTTGAAAGAAGCACAATTTCCACCTTATTTTTCGAACTTTGGCAGTCTCAATGTCTG
TCTCCGTTGCTTCAGGAAATAAGCTGATCACCATCTAGTCGGGAAAGTAACCCTACAGGG
TTTGTGGAGACATGATATCTATGCCAATTTGAACGCTGAAATGTTTTTTACATACCCTCT
TGGGTCCAATGGAGGCAGTTGGTTGAAGTAGCAAGACGTTGGCCTTTCTTGGACTTGTAT
AAGTATGATACAAATATACACTTGAATAAGTATGACTGTTATTCATACTTGAACTTATCT
CATTGCACCTCTTCTCAGCAGCTCTTCATTTGAGAAAATATTTTTTCAGATCATAGATCA
AAAAATCATACCATCAAGGTGGCGGCAGCAGGTGCCAGGAGGAAAAGGGTACTTGCTGTG
TATCCTGGGTCAGTAATGTTGAAAACTGTCTTCTTCAGCTTCCTGTCCTTCTATGTGTTG
TGTCTCTTGTGACAGTTGTTTTGTCTTCAAGCCACTGACTTCTGGAATTTGCAGATTTTG
CAATCCATGCAAATGTGAACAAAAGCTCTATGTTACTGACCATTGTTGTTGTTGTTTATA
GTGCAAAATAAAAATAGCAAAAAGGAAAAAAGATCAATGGAGGCCTTTTGGTGCTTATCA
CAGGCTGTGCTCTTTCACTGACTGAATAGAAAGAGGAGGCAGAGTAAACCTATCCTATAT
ACACCTCAGTCCAAGCCTGGTCTGTATTATGAATGGGGCAACATGGAAAAAGAAAATAAA
ATCAGCAGACCACATAAACATTTCCAGAACTTTCTTTTTTAAAAAAATTTTTATATTTTT
CTTTTATTAACTACCAAGTGCTTAGGAAAAAAGATGTCCAGAACTTCTAATGAAGAAACT
GATGAATTCATGAAATTGCTAATAAGATTTAGCAAAACAAAAAATTAATTACATGAGATT
GAATAACTAATAATGTTTTCTTGACTTTTATTTAAAATACTGATGGCTCTTTACTTATAT
ATTTTGTTTCCCAAATTTAAGAAAATATTTTCTCTTATGCTATCTAAAGTTTTCAGCAAT
TTGATAAAGCATACATTTGTGAACAAAAGTGAAAACATTTATTTTTTTCTTCCTACTAAG
TACCTCCAAAATTTGGAAATGATTTCATGAATATACTTATTTTTAATGGAAATGTAATTA
TTTCCATAAGTTCAATAAGAATCACCTCTATAGCAAGATACAATTGGAAATATTGGTTAC
ATTGTCATGACTTTGGAATGTCATATTTAAGGGGTTTATAGATACTGTAAACAAAGTCTA
AAGTCTGTCTTGATTTGGCTACCTAGCCTCAAGGGTTTGTTGTTGTTATTTTTGAGACAA
GGTCTCCCTCTGTCGCCCAGGCTGGAGTGCAGTGGGACGAGCGTGGCTCACTGTAACCTC
TGCCCCCTGGGAGGGGGAATCCAGTGATTCTCATGCCTCAGCCTCATGAGTAGCTGGGAG
TCAGGCTGGTGCCATCACGTCGGACTAATTTTTGTATCCTTTTTTTTTTTTTTTGACGGA
ATTTTGCTCTTGTTGCCCAGGCTGGAGTGCAGTGGCGCAGTCTCGGCTCACCTCAACCTC
CGCCTCCTAGGTTCAAGTGATTCTCCTGCCTCAGCCTTCCAAGTAGCTGGGATTACAGGC
ATGCGCCACCATGCCCAGCTAATTTTGTATTTTTAGTAGAGATGGGGTTTCTCCATGTTG
GTCAGGCTGGTCTCGAACTCCCAACCTCAGGTGATCCACCTGCTTCGGCCTCCCAAAGTG
CTGGGATTACAGGCATGAGCCACTGCACCCAGCCTTAATTTTTGTATTTTTAGTAGAGAT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGCAGAGCTGCACCCGC
GGTTGGGTCTAGTCGTCAGCAGCGCAGCCCCATGGGTCGCCCCATGGGGGACCCTGGCTT
GGGCACTGCGGAAGCACGTGACGCTGGGTCGCTGGGTCGCTGGGTCGCTGGCGCCAGTGT
GCAAGATGCTCCGCAAGGAGGCAACGGCCGGCTGGATGGTGCTTGGCTGCCGGCCCTACC
TGGCCTTTACCGCCTTGAGCGTGCCTGGCTCATTCAACATCAACCTCTATTCAGTGGTGT
GCGCCAGCCTGGGGCGGCTGTGGGGTCAGCGTGCTACTTGCTGCCAGATGCCTCGGAGCA
CGCTGCTGCTGCAGGAGGGCAGCATCCTGGTGGCCGTGATGGTGCTGAACTAAGGGAGCC
GCCACGGGCAGAAGCTGTGTGAGGAGAGTGCCCGGCGGGTTGTTCTCACCTCACTGCTCG
CCTGCCTGCCCTCCTGCTGGTGGGTCCACTTCCTCAAAGGGGGATATGAGACCTTCTTCC
AGGGTTGCATGGATGTAAAACTCGTTTCACTTGTTTCAAAGTGAGAGAGCTCTCATCAGC
CAGTGTGGAAAGCTAGTAGTGCTAAACATCAACTACAGGCCAGCTTATGATCAGTGTGGT
CCAGTTGAAATCCTTTCCTTCCTCTACCTTGGAGGTGCCTACCATGCATCCAAGTGCAAG
TTCCTCATCAAGCTACACGTCACAGCCCAGCTGCATGTCCCCTTGTGGACCTGCCTGTGA
GGCTTGCAAGATCCACCTACATAGAAATGGATCCTTGTGGAAGAAGGCCACATGGCTGAC
ATTAGCTCTCACTTTCAAGAAGCAATAGACTTCATTGACCGTGTCAGAGAAAAGGAAGGC
AAGGTCCTGGTCCACTGTGAAGCTGGGTTCTCCTGTTCACCCACCATCTGCATGGCTTAC
CTCATAAAGACCAAGCAGTTCTGCCTGAAGGAGGCCTTCAATTATGTCAAGTGGAAGAGG
AGCATGATCTCACCCAACTTTGGCTTCATGGGCCAGCTCCTGCAGTAGGAATTTGAAATC
CTCCCTTCCACACCGAATGCCCAGCTTCCCTCCCACCAGGGGGAGGCAGCAGGCTCTTCA
TTGATAAGCGATTTGCAGACATTTAGCCCTGACTTGAAGGGTGTCTACTGCACATTCCCT
GCCTCAGTGCTGGCCCCAGTGCCCACCCACTGGACAGTCTCAGAGCTCAGCAGGAGCCCT
GTGGCCACAGCCACATTCTGCTAAAACTGGGATAGAGGAACCAGCTGAGCCGCAAGAGCA
GCTATGGTTTTTGTTTTTAAGAATGGACATTTCACATCTGTGCAATACTGAAGACCTCAC
TTTGTCATCTTGCCCCAGTGACATAGTGAGAGGTCACCAGGCTTGCAAATGAACTTCACA
CAGACCTCAGGGTAGGTTCTCAGGATTGAAGGAAGGCCAAGCAATTACAGGAGCACAGCA
TGTGCTGACTACTGTACTTCCAGACCCCCTGCCCTCGCGGGACTGCCCAGTCCTTGCACC
TCAAAGTTCACCTTTTCATTTCAAGCATAAGGCAATAAATACCTGCAGCAACATGGGAGA
AAGAAGTTGCTGGACCAGCAGAAATGGCACTTATGAAGCCAATTCATTTGAAAGAAGCAC
AATTTCCACCTTATTTTTCGAACTTTGGCAGTCTCAATGTCTGTCTCCGTTGCTTCAGGA
AATAAGCTGATCACCATCTAGTCAGGAAAGTAACCCTACAGGGTTTGTGGAGACATGATA
TCTATGCCAATTTGAACCCTGAAATGTTTTTTACATACCCTCTTGGGTCCAATGGAGGCA
GTTGGTTGAAGTAGCAAGACGTTGGCCTTTCTTGGACTTGTATAAGTATGATACAAATAT
ACACTTGAATAAGTATGACTGTTATTCATACTTGAACTTATCTCATTGCACTTCTTCTCA
GCAGCTCTTCATTTGAGAAAATATTTTTTCAGATCATAGATCAAAAAATCATACCATCAA
GGTGGCGGCAGCAGGTGCCAGGAGGAAAAGGGTACTTGCTGTGTATCCTGGGTCAGTAAT
GTTGAAAACTGTCTTCTTCAGCTTCCTGTCCTTCTATGTGTTGTGTCTCTTGTGACAGTT
GTTTTGTCTTCAAGCCACTGACTTCTGGAATTTGCAGATTTTGCAATCCATGCAAATGTG
AACAAAAGCTCTATGTTACTGACCATTGTTGTTGTTGTTTATAGTGCAAAATAAAAATAG
CAAAAAGGAAAAAAGATCAATGGAGGCCTTTTGGTGCTTATCACAGGCTGTGCTCTTTCA
CTGACTGAATAGAAAGAGGAGGCAGAGTAAACCTATCCTATATACACCTCAGTCCAAGCC
TGGTCTGTATTATGAATGGGGCAACATGGAAAAAGAAAATAAAATCAGCAGACCACATAA
ACATTTCCAGAACTTTCTTTTTTAAAAAAATTTTTATATTTCTCTTTTATTAGCTACCAA
GTGCTTAGGAAAAAAGATGTCCAGAACTTCTAATGAAGAAACTGATGAATTCATGAAATT
GCTAATAAGATTTAGCAAAACAAAAAATTAATTACATGAGATTGAATAACTAATAATGTT
TTCTTGACTTTTATTTAAAATACTGATGGCTCTTTACTTATATATTTTGTTTCCCAAATT
TAAGAAAATATTTTTTCTTATGCTATCTAAAGTTTTCAGCAATTTGATAAAGCATACATT
TGTGAACAAAAGTGAAAACATTTATTTTTTTCTTCCTACTAAGTACCTCCAAAATTTGGA
AATGATTTCATGAATATACTTATTTTTAATGGAAATGTAATTATTTCCATAAGTTCAATA
AGAATCACCTCTATAGCAAGATACAATTGGAAATATTTGTTACATTGTCATGACTTTGGA
ATGTCATATTTAAGGGGTTTATAGATACTGTAAACAAAGTCTAAAGTCTGTCTTGATTTG
GCTACCTAGCCTCAAGGGTTTGTTGTGGTTATTTTTGAGACAAGGTCTCCCTCTGTCGCC
CAGGCTGGAGTGCAGTGGCACGATCGTGGCTCACTGTAACCTCTGCCCCCTGGGAGGGGG
AATCCAGTGATTCTCATGCCTCAGCCTCATGAGTAGCTGGGAATCAGGCTGGTGTCATCA
CGTCGGACTAATTTTTGTATCCTTTTTTTTTTTTTTTGACGGAATTTTGCTCTTGTTGCC
TAGGCTGGAGTGCAGTGGCGCAGTCTCGGCTCACCTCAACCTCCGCCTCCTAGGTTCAAG
TGATTCTCCTGCCTCAGCCTTCCAAGTAGCTGGGATTACAGGCATGCGCCACCATGCCCA
GCTAATTTTGTATTTTTAGTAGAGATGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAA
CTCCCAACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved