Pongo_pygmaeus Locus Poly:23:SNORA68
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:23:SNORA68
Pongo_pygmaeus
Poly:23:SNORA68
5
SNORA68, SNORA68
1001..1126, 2696..2808
3808
GGTGTGGTATAACTGTCTGCTTCATCTGCCCATTTTAATTCTAGAAGGATCTGTAATTG
AAAATAAAAGAGTGAATTATGAAAACTGATTAAGCCAAACCCATTGTATTCATATATTCA
TGGTAAGTTGAGAAACACCTTGTGCACTTGCTATTTAGAATATGTGTAATTATTTGGAGA
ATTTATTAATAGCAGATGAGCGAATCAAACAGAATTGCTTTAGAATTTAATGTATAATAT
TTAATTGAATAATTGATTAACTTCTGACTTTAAGTTCAATGTATAAGAAAACTTTACTAA
ATTTAAAGATACTATTGGAACATTCAGAAGAACCTAATATTCACCATATTTATGTTTCAT
ATGTTAGAGTTACTTAAATTATTTTTGTTACACAGTTGAATGACTTAAAATGAAAACAAG
TACATTAAATGTATGAATGTAATTTTTTAATGTTTAAGAATTAAAATTGGCCAGCGTGGT
GGCTCACACCTGTAATCCCAGTACTTTGGAAAGCCAAGGTTGTCAGATCACAAAGTCAGG
AGTTCGAGACCAGCCTGGCCAATATGGTGAAACCCCATCTCTACTACAAATACAAAAATT
AGCTGGGTGGTGGTGCGTGCCTATAGTCCCAGCTACTTGGGCGGCTGAGGCAGAAGAATC
GTTTGAACCCGGTAGGCGGAGGTTGCAGTCGCAGTGAGCCGAGATCGTACCACTGCACTC
CAGCCTGGGCAAAAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAAAAATTAAA
ATTAAGTTTGTAAATGGGCTCACACATTAATCAAAGGCCCCCTTAAAAGTGACTGTTAAA
GTTTTATTTATTCATTAATAGAACAATGTGATTTTTATTTTGAATTTTAAAGCTTAAGGA
CAAACAGTCTTTTGATCTTATAACCTTAAATGGACTATTAATTTCTAAAAACCAAACTCA
TCATAAATAATCTTTTCTGGTCATAAAAACTGCCATCACTCATACCTAAACCCAAGAATC
ACTTTCTTATAGTGATGATTTAAACAGATGCAAACAGCAAGCACATCTTGTCACCTTTGC
GGGGCTGTGGCTGTGCCCCTCGCAGTAAATTTGGAGGTTCTACATCCCTAGTGAAAAAAA
AAAAAAAGCCTGCCATCATTGACACCAAAACACTCATAATGACAGTACCCACTGTAATGC
TTAGAAGTGAAAAAATAACGTGTCATGAAAGAGACTAATTGAAGGGGCTTAATTTAGATC
AGGGGTTCAAAGATCACTCTGGAAAGTGCCTTGTGAGCAGAGACTTCAGAAAGAAAGTTT
ATCCAAAGGAAAATCAAAAAGAAGAGCGGTCCAGGTGGGATCCTAAAGAGAGCTTAGTAT
GACAGAAGAATTGAAGGAAGTTGGGAAATTCAGAGAAGCTGGAACCAAGTAAGTCAGAGG
GAGAGTGGCATGGATGGGACAGGCGGAAGAAGCTGCAGTCAGATCATGCAGGCCTTTGGA
GACCAGGTAAAACCATATGTTATATAAACACAAATATTATACAAATCCCTAAATGTAATG
GAAAACCTCTGAGGATTTTAAGCAGAGGTCGGGGTGCTGAGTATGGTTGAATAGCCTGGG
TGTTGCACAACTCCATGTTGCACCAGTGGCATAGTTCCTGGTGTGATGCAATATTGCCCC
CAGGCAGGTAACATAATCAAATTAGTGTTAAACAATTACTCTGGTTGCTGTAGGGAGAAG
AACTGTGGAGGTAAGAGTGGAACCAAGGAGATCATTTAACTAGCTAATGCAGACTCCAAT
CAAGTAGCCCAACACAGTATTTGTGGTGATAGGGAAAAGTGAACAGACTGTTTTTTTTTT
TTCTATTTCCATGGCAGACAGTAGAAGTCTGGGTGGATTTCTGAATCTGAAAATAACCTG
TCTTAAATGGTGCTTGAGAAAAATTAATCGTCCATCCAGAAATGTGCTAGAGCTGATATA
CAGCAGCTTGTATTGGTTCAGTAGAGACAATGGGGTCCACCTTTCCCCCACTCCTCATTC
AGTGACATCAAGTTGATAGCTTGAAATCTGCCTTGGTGGGAGTATTTACACCATGGAGAT
TGGCAAACACTACCAATAGAGCTTCTTTCCCCAGAGAGCTGATTGTGAAACATTTACCAG
CACACCAGTGCTTCCAGTGCTTTTCGCTATCTCAACACTGGAATACTATTTAAAGAATCA
CTGCATATAATATCATATGATGTCAAAGAACATTCATACGGTTCTTATGAAACCTTAAGA
AAGGAATGGTTATAAGAGACACTGGGAAGAAAATATCTGTAAGACTGGGTGGTGCTTTGC
AAATGGTGGTAATGGGAAGAGAGGAGCAGATTGTATTTTCTTCCATGGAATAGGAATCAT
TTCAAAGCATATATCTTTGATGAAGATTACAGAGAGAACATTTCACAATTTGGTTCCCTG
TCCTCTGTATTTTAAATGTCCCTACTGCTGTCAAGGATTTCAAGTGCCTTTTAAAAATTC
CATATTGTGGTAGCTCTGAGTTCTGAATTCTATCACTATTTACTGGTGCAGTTAAATGAA
TAAATAATAATTGAATACCAGACTCTCAGTCACTGTCTTGCAGAAACAGAAGCTCTGCAG
AGAGCTGGAGAAGAGCATGCTTTAAAACTGAAAAATGTCTTCCACTTTGTAAATTTGTAG
CATCTNNNNNNNNNNGATGATTTAAACAGATGCAAACAGCAAGCACATCTTGTCACCTTT
GCGGGGCTGTGGCTGTGCCCCTTGCAGTAAATTTGGAGGTTCTACATCCCTGGTGAAAAA
AAAAAAAAGCCTGCCATCATTGACACCAAAACACTCATAATGACAGTACCCACTGTAATG
CTTAGAAGTGAAAAAATAACGTGTCATGAAAGAGACTAATTGAAGGGGCTTAATTTAGAT
CAGGGGTTCAAAGATCTCTCTGGAAAGTGCCTTGTGAGCAGAGACTTCAGAAAGAAAGTT
TAACCAAAGGAAAATCAAAAAGAAGAGCGGTCCAGGTGGGATCCTAGAGAGAGCTTAGTG
TGACAGAAGAATTGAAGGAAATTGGGAAATTCAGAGAAGCTGGAACCAAGTAAGTCAGAG
GGAGAGTGGCATGGATGGGACAGGAGAAGAAGCTGCAGTCAGATCATGCAGGCCTTTGGA
GACCAGGTTAAAACCATATGTTATATAAACACAAATATTATACAAATCCCTAAATGTAAT
GGAAAACCTCTGAGGATTTTAAGCAGAGGTCGGGGTGCTGAGTATGGTTGAATAGCCTGG
GTGTTGCACAACTCCATGTTGCACCAGTGGCATAGTTCCTGGTGTGATGCAATATTGCCC
CCAGGCAGGTAACATAATCAAATTAGTGTTAAACAATTACTCTGGTTGCTGTAGGGAGAA
GAACTGTGGAGGTAAGAGTGGAACCAAGGAGATCATTTAACTAGCTAATGCAGACTCCAA
TCAAGTAGCCCAACACAGTATTTGTGGTGATAGGGAAAAGTGAACAGACTGTTTTTTTTT
TTTTTCTATTTCCATGGCAGACAGTAGAAGTCTGGGTGGATTTCTGAATCTGAAAATAAC
CTGTCTTAAATGGTGCTTGAGAAAAATTAATCGTCCATCCAGAAATGTGCTACAGCTGAT
ATACAGCAGCTTGTATTGGTTCAGTAGAGACAATGGGGTCCACCTTTCCCCCACTCCTCA
TTCAGTGACATCAAGTTGATAGCTTGAAATCTGCCTTGGTGGGAGTATTTACACCATGGA
GATTGGCAAACACTACCAATAGAGCTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved