Pongo_pygmaeus Locus Poly:29:SNORD113
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:29:SNORD113
Pongo_pygmaeus
Poly:29:SNORD113
14
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 2688..2765, 4062..4136, 5635..5711, 7961..8034, 10144..10215, 14363..14434, 16435..16512, 17935..18009, 18861..18935, 19815..19881, 20695..20767, 21626..21697, 22614..22682
23682
CTTGGTTAAATTTAGACAATATTTTTGGTGCTGTTGTAAATGAGCTTATTTTCTTCATT
TTCTTTTAATTTAATTACTTATTAATATAGTCACTACTGAATTTTTTTGATGATTTTCTA
TCCTGCAATTTTACTAAAGTCATTTATAAGTTCTAACCGCTTTTTTTTTTGTGAGGTAGT
TTGGATTTTCTGTATATAAAATCATGTCATCAGCAAATAGAGACAATCTCACCTCTTCTT
TTCCTATAAAGATGCCTTTTATTTCTTCTTGTTCTTCTAGGATAAGTCTACTTTTCTTCC
ACGTAACAACCACAGGATAGATGACATTCATTTTCTAAGAAACAAAATCTTGGCAGTTAG
ATCCGTGGGGTAAAGAATATAGATACTAATGTAAGTTAACACCTCAAGTTCATGTCCTTG
GTTTGGATGCTTTGTTCAGGAGTGTTTAGTGGTATTTCAAAGGAATCAATATCTATAACA
GAAATTAAAATAACCAGGAATGGACCAGTGATGGAAATGTGTTCTGAAAATATGTTTAAT
ATGATTTGGCACAACTGAAGTGATAAAAATATAGTAGTTAGACCATTTATATTCACAATT
ATTTAACATTGTATCTTATTTTCTACCTCAAATGATTTAGTCTTTTCCATATTGGTATGG
TCCAGGCCGATAACTCTTTGTGTGGCAGCCTGAGAGAATATGGAAGACATTGTCAGTGTT
GGAAGATGGTGGTTTTATCACTTTTCGTTGCACTGTCTTTAAAACATGGGCAAATTGACT
AAAAGAAGACTACAGAAGAAATAATGGTGATTGTGAATTTGGTATGAAGCATGGATGTTA
ATTAATCACACATGTTCTCTGAGGTCCATTGTAAAAGGAGACCTAGTCTTCAGGGAGAGA
GCCACTAATGGGGAGATCTTATTCCTAGAATTTTGTGATTATATTATTGTTCATGAACCA
ATGAATAATAAATGAATGATATAAAGGAAGAAAAACGTGCTTGGACCAATGATGAGTACC
ATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCATTACA
AAGAGACATGTATTATTCCTTTTTTGGGAAGTGAGCCTATGGTACCTTTTCCTTGGACTT
TGTGGTTCTTGGGGATGGATTGCATTTTTGTTATAAAATCAGCCCATGAATTAAAAATTT
ATCAATGAGTAAAACAAGAAGCATAAGTCATGTACTTATTATCAGTGAATGTAATGAAAC
ATGGATTATTATTAAAACTTATCTGAGACTCCCAATAAATTAATACCCAAGGCTTCCGCC
ATTCTGGTAAGGAGCATATGGTCATTTGTATGCAAGAGTCAAAGTTTTTGTTCTGTGTTA
GTGGTGGGTTGCTGACTATTTTATTAAGAAAATGAAACATCTTTAATCATGTAAATAGTT
GGTTAAATAACCACTTAACTGAGACCAAGCAGAGACCAATGATGAGTGTATTAATCTATT
TTTTAATGGATTTTTATTAAACAAATAAAAAAAGAAATAGTGTATTCTTCCTGAGGGCAA
TGACTCTAGACAGATGTAAATATTCTTGTCCAGTGCTGTGAGAGCACAGATATACTGAGA
TCTTTTGTATATGAGAAGGAAGGTGCACTTTTATGTGTCAGTTTATATTTTAGAGTCAGC
AAACCATGGACCAATTAGGAACAAATGTTATGATATGAGAACGCTGATTCTTGTTTTTTT
TTTTTCATGATAGACATTCTAAGAAAAACTCTAGGCTCTTTCATTGTTTTTGGAATACAT
ACATGGTCCTTTCCAAGTAATTTCTTAGAAAAATGTTTTTAAAAAGACATTTTTAAAAAG
AGCCTTTTAAAATGTTTTTAAAATAAGGCTTTATTTTTCTCTGTAGAATGAAAACCATGT
AGCTGGTTTTATTATCCTCTAATCATGAAGACCATTATTGTTATTTGTGGACTAAGGAGC
AGAAAGACTGATGTAAGTAAACATCAGATTGCTGTTTTGGGCTTGGATGGTATTCATTCA
TGGGAACCCACTACATTATTTTAATAAAATAAATGGTTAAATAACACATGAAATTAAGGA
ATGCCAGTCATAGACCTATGATTGTAATGTGTCATCAACAAAATTTTATGATTAATTCAA
CCCAACCCAACTGAAGACCATTGTTAAATAAATGAAGAGCATTTCATATATTGTCATAGT
AATTTAAATTCCCATTTAATGTTTTTGCTATAGTTGCTTAACGTATTCCTTCACTGACAG
ACATTTAAGTTGTTGACTTTTTGAGGTAGAGGTACCTTGGGAGATATTATATATTAATTT
GCTCAATTGTGGGCTCACATGGTAGGTCCATGGTTTGCAATCACATTAATGAGTAGACAA
ATCAAGTGGAAGAGAAGCTGGTAGACACCAATCGTAAGTATGAGATTTAAATGCAGCAGA
GTCGCTGATGAATCTCTATGTGTAAACGTGGTTGATCACGAAATATGATCTAGTGTATTT
GTTCTGCGTGAAAGGGAGTAATGAACAGATCTTGGTTCTGTTAAAGCCTTTTGTTCTCAG
TTTTGTGTCATTAAGGGATATTGATCATATAATTATTATTCCTGAAACCATGAATGACTG
AGTCAGTTCAACAAGGTATAAATGAATGAAGAAATAGAATGCTTAGCCTGGATCAATGAT
GAGTATTGGTGGAGGTGTCTGAATCAACACTTTTGATTAAGCCCTCTGTGTAACTCTGAG
ATCTGTTATTGAATGAGAACCAGCCGATATTCTCTGTAGAAATTACCTAATAGAAGTTAG
GAAAATTCAATAAAACTTTTTCCTGAGCTTTTGTAGTTCAAAGATATGGAATGTATTATT
TTAAGTGAATTCAATGCATAAATAGAGAAATGTGTATACATGAGAGAAGATTAACAGGCC
TACTTATGGAACTGTTCTTTGAGTACAATGAAAAAGTATTATAAATATTAACACTGGCAA
TAAAACAAGTATAATTATTAATCTGAGGTAAAATCCTATTATACGGAACATATTGTATCT
GCAGTTGAGACAATTTTTTGGGTTTTATAGTTTGCTTTTTTTTTAATTAAGAAAAGGGAA
AGTGTTTGCATCAGCCAGAAATCCATTAAGTAATGTCTACTTAACAGATTTTTATATAGA
GAAGTATTCATAATCATTATAGATCTTATTCTTGGGCTAGGTGATGCATTCAATAGTGTC
TATTATACTATTTAAAAGTAAATGTTCAATACTGGCCTGAAAAAATTGCGTTTTTGAGCC
AAGGTTTATTGTTATCTAGTTCTGCTTGACTAACATCCATTGAGAAAACCCTATATCTAT
TCTAAATCTGACTTTTTCTCTCCAGAGTGGACATAGGCCAGCTGATTTAATAATTTAAGA
AATAACTGTTATCCTGAGTAAGGAGCATAGAGACAAATATAAGTAAGTTCCTTATTTCAA
GTTCTTTCTTTGAATGGTTTGTTTTTGGGTGTTAGCTAAAGGATTTCAAAGGAATCAATG
TCTACATACATGAAATAAATAAAACACCCCAAATGGACCAATATGGGAATGTGTAATGAA
CCATGAATTATGTTTAATCTAAATCATCACAACTGAGATGATTACAAAAGAAGACAAAAG
TTAACTTATTCTCAGAGCAGCTCAACATTATTCTTTATTTCATGCCATGGTTATTTTACA
CATTCTCTTATGGGTAGAGATCCTGGCTGACATCCGTTTTGGGGCAGCGCATAAGAATAT
GGAAATAGATGATTTCGTTGTTTTTTATCGGACCATCTTTGACATATATATGAATTAAAT
AGAAGTGGGCTATATCAGAATGAATGCTGAATGTGAACTGAGAGCATGCAGGGGCGTTGA
CCAATTCACATGTGCACCTTTACGTGTCATGGCCTAAGAAATGTAGTCTGTAGCTCTATG
GGCCAAGAGCCTGAAATTTAATAATCTTGTTTTGGGGATTTTTGATTGTATCATTATTTG
TGAGTCAATAGGTTAATCAATAGATGAAAAAAATGCACATCATGGACCAGTGATGAATGT
CATGGGGTTTCTGAAACAACAATTTTGATTAAACCCATCTGCAACTCTGAGGTCCATTAC
AAAGAGACACCTCTTCATTCTTCATGGGAAATGAGTCTATAGAACCTTGTTCATGGGCCT
TTTGTTGCTTGAGGGTGTGAATTACATTATTATAATAAACTTTGTCCATGAATATAGAAT
TTTATCAATGAATGAAGAATAAGAAAGGTATGCATGCACTTACCTACTGAGGCATGTAAT
GCAACATGGGTTATTATTGGAACAATTTTGAGATTCTTAGTCCCAATAAATTAGTGGTTA
AGGCTCTTATCATTTTGGTAAGGTGCATATGGTCATCTGTGCACAAGACTGAATGTTTTT
GTTCTGTGTTGAGGCAGGTTGCTGGTTGATCATTTTGTTAAGGAAAAGGAAATACATTTA
CATAAATAAATAGTTGACTGAGTAACTGCAATTGAGAGAGGGAGAGCATGGAATGATGAT
GAGATCTGTATACGACCACACTCATGATTAATTCAATCTTTTATGGAATTTTACTTAAGC
AAACAGACAAGTTTTGTACTAGATTCACAGTGTTTATTATATTATCTAAAACAAAAAATT
TCATGGTGAGAGATATTTCATCTTGACAAAAACAATTTATGTAAGTTAATAAATAGAAAG
AAGTGCTTTCTCTTCTCAAGTGTTCAGAATAGGGTACAAAACAAGGTTTATGATTGTTTA
CTACACAGCTATGATTCATTTTAAAGAGCTAAACATACAGCATTTGATTCTTTTTAAAAT
TTGCGTTTTATGCTGCAGAATGAACGCACTCTACCTGATTTAATTATAGTCTTCTGGTGA
AGATCTTGCTGTTATCTCTGTGAATCAGGAGAGAAGAGATCGATGTAAGCAAAAATCAAA
TTTTATGTTCTTGGGAAACTTGATCAAGTTTATTCATTGAATTATTTCAAAGGAATAAAA
GGCTACGTACATAAATGAGTCAAAGGTGGTTATGCATGGACCAATGGTAGAAATGTGTTA
TGAATTAAGAATTATGATTAATCCATTTCAGCACAACCAAATTCATTAGGACAAAAAGTT
GGAAGGTATTTCTGTCATTTTCAGAATGCCTTAATATGCTGTTTTTGTACCATAGTGGAT
TTAAACACTTCCCCATTGTGATTGTTATTGACTGTTAACTAATTAAGGGAAGAACATAAG
AAAATGGAAAATCTTGCCTATAGCTGTGGTATAACTTTGTGGTTATACCATGATATAACC
ATAGTAACGTCTTAAAAATATGGATGTTAAATGAAAAAAGCCCAACCATGGACTAATGGC
ATATATGGAATTGACATGGTGCAATTTGTGGAATGAATTAATTCACCTTTCCAATACTGA
GGCTCATTGCAGAGAGAGCCAGTCCTCTAGTTCTGTGGAATATGAATCTTACAGACATAG
TTACTTCTTCAAGGATCTTTTTGCCCTCTAATTCATGGATAGTGATTTTACTATTAGTGA
ATCAATGCCTAAATCAAGAACAGTATAATTGAATTAAAGCACAGAATACCAAGTCTGGAT
CAATGATGAGTATGCGTGGGGCATCTGAATCCAATATTCTGATTATACCCTATCTGTATC
TCTGAGGTCCATTGCATCTATGGGAAATGTGCTTGGAGAGAAAGTTAGACATATTCAAGG
AATATGTTCTTGGTCCTTTTTGGTTAATGGGTATAGATTGTATTATAAGCAAATCAATGA
ATGGATAAAGAAAAATAGAAATAAAGACAAGGAAGACTTCATTTCATTCAATTATGAAAA
GAGCTAATGATGTTTTGAGTTTAAATAAGTCTGCTCCTCCTTTGAGAGCATATAGATAGA
TATGCACTCAATGTTCCGAGTTAGTGGCAAGTTTCTGGTTGAGTGTCTTGTTTGATTTAG
AAAGGGATAAAACATATACTTAAATGATGTATTTAGTTTAATAATACTTAATATAAATAT
TAGCCAATAAAATTAATATTCATATTCAATAATAATAATATTACAGATCATGCTAAATAC
ATTAACATAAATTTTTATAATAAACAATAATTTAATACAATTAATAATAAACATTAAAAT
ACTAATGATTAGGTTGTGAAATGTGGAGAAAGTCTAAGGATGAACATTGAAAATTTGAAT
GTAATAACCAAAAATCCTCTTATGTTTGCTCATTTTTATTTAAAAAGAAAAATGCAGATG
CATTTTTATGACTTTTATGAGTAATAAGTGAATAAATAGATGCTAGTGTCATGAAGGGTT
TTTGTCCAGTGTACTTTGAATTCATGAATAGTGGCACTATTATTATGAGTAAAAGAATCA
TTTTATATCTCCATCCCTTATTTAAAAGAGGGCAAATCCTGGACTAGTGAGAAGCATATG
TAATGTATGAAGGGGTGTGATTAATCTTGTCTATCCTCTTGAAGTCTACTTAAACAAAAA
AGGTCCAGGACCCTCCTTCCTTTGGAAGGGTTGTAAAGACCCACTCTCTAGACATATTTT
GATATTAACATTTAAATGGAAATTAATTAAAAATAAAAATTCAGTTCCTCAATCGTACTA
GCCGCACCCCAAGTCACATGTTGCAAGTGACCACCATTTCAGAATTGCCAATAGAGAACA
TTCGTATCACTGAGGAACGTTCCAACAGCGCATACAGGGCTAACATGAGCAGTTGCAGGT
AATAGTATTTAATTTTAGGTAGCAGGTGACTTCACCATTTTGAGTTTTCTTTAGAAAAGA
GAGTAGATAATTAAATTATTTTTTGAGTTATTAAATAGATGAGTAAATAAACGAATCAGT
AAATAGTTTGAATTAAAATAACTGTGGCCCACTGGTCAGACTGTGTTTTAAAACAACAAT
TTAAATTCATCTTATAGTGCAAAAATTTTCCTTATTAAAAATGTGTCTTCCCTTTATGCT
AGGAATACCTAGGCAGGTATTGAAAATTGCTCTTTTAGTGTTGGGTGGTAGATTCAAAAA
TGTTCATGATATTATTTCATGCTAAGAATTACGTCAATACAAGAAAAAGAACTACTGTTG
GGTTGATGATTAAAATTTGACACAAACCAATGTTTATGATCCATCCAGTAATGGAGAACT
AACTTCTACTTAAAAATGGATTTAAAAATGTACACTTTTTATTCTTATAAAAATCTGCCT
TTTCCTCCAGAAAGAATAGACGAGATTGGATTTGGTCATTTTCCCAAGGTGAAGAGCATG
GTGATTTCTTCTGTGGTAAGGAGCAATGTTAGTAATGGAGTTTCTGTTGGTGGGTTATGC
GGTTGGTTCATGTGTGATTATTGAAGAAAGGAACAAAAGGCCATATGCACAAAAATAAAA
ACATCAAGTAACAACCAATAATAGGAATGTGTTGTAGGCCAAGGAGTAGGACTGACCCAT
TTCAGCACAATAGAGACTTATTTTTTAAAAAGGTAGAAGGAATTTAATTTTCAGAAATGT
TTCATATTTTGTAGTATTTCTGCACCATGCTTGATTTAAGCATTTCCATATTGGAAGAGA
TTCAGGTTGTTAACTGTTCAAGAGAAGCTCTTGTAAGGTGAAACATGCTGTTTGTGTTCT
AGTAGGGGATACCATTGTGGATTTTCATTGTTCATTATACCACCTTTAAAATTAGGCAAA
TTAAATGAACATAGCCCAGTCATCGGCCATTCATGTTGATAGTACTGATCTGAAGCAAGA
TTTGTGGATTATTCCACATGTGGCACTGAGATCTAGTCTGACAGCTTTGTGGGAATTGAA
CCTAGAGATGCATTGTCGTGATATCCAGGATCTTGTTCTTAGAGTTTGTGATTCATGGGA
AAATGAAGGTATACATGAATGAAGAAAAAGAGTGCCAAGCCTGGACCAGTGATGAGATTG
GAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCATTTTAA
AAAGAGGCTGCCATTTTTCCCTCTAGGGAAATGAGCTTATAACACAAGTTCAGAATATTC
AGGTATCTTGATCATGGGTGTTCATAGTTTTTTGGTATAGATTCCATTTTATAAGTAAAT
CAATGCATAAATTTTGCATAAATGGGTAAATATAAGGAGAGCTTGACATTGACCAATTAT
GAGAGTATGTAATGACGAATGGATTATTATTATGTGCTTCTATAGCACTGAATTCCAGTG
ATATATATTGATAGAGGTTGTTGCCTTGTTTTGGAAGGAGTATGTGGACAGATGTATGCA
AGACACAAAATAATTTTTTGATGTTGATGGTTGTTTACTGATTGGTTTTATTTAGAGGAG
GGAAAATTGCATAAATAAATAATAGATGAAACAGTTATTTAATTGGAAATAAGTGAGCAT
GTTTCAACTTGAGAATATTCCTTATGAAAAGTTATTATAAATCCAACTCTGTAGTGAGTT
TTATTAAAAACTAAAAAAAGCATCTAGTTTCTAAATCTTGTGGATAGCATAATGGACATA
TGGAGACATAATATTATTCAAGCTTCTTCTATAATGTAAGTAAATTCGTATATATTGAAT
TCTTATATGTGAATAGAATATGTCCTTGTCACAGTTAATTTTTTAAAAGAGGGCATAACA
CAACTGAGTGAGAAATGAAAATGAAAATTAATCTTTGTCTATACTACTGATGCTGTCTTC
CTGGATAGGTGTGGGAATACAGACATTGAACATGAAAAGCTTCCTGCTGTGGGTTCTTCA
GGAGTTTACTGCTGTGTGTGTGTGTGTGTGTGTGTTAGTATTTATGAATGTATAATAAAA
TATTCCATGCGTCATAACATAAATCAAAACAATAAATGAATTAATATATAAGTAGGGTAA
AGCATTTACCATTGATGATAATATGCCATGAATCATGAATTTAAATTCATCCATTTCTAC
ACACGTTGAGTCTATTAAATGAAAAAGACGATCTAAGTGGTTGCCTGTGTGGGTAGGTGT
CTATAGACAGATGTGTGCCATAGTCATAGTTTTTGTTTTGGGTGATGAATTTAACAGTGT
TTATTGTATTATTTAAAGTTAATAGTTAAATCAAGAAATAAAAATAAGTGCAGTTCTTGG
GTCAGTGATAAAAATGGGATTTGAATCAACTTTATGATGAATTTAACATCACACAACTAA
TGTCTTTTAAGTCAATCTAAATGTGTACTGTTCATTCTTTTGAAAATTTGTATTCAACTC
CACACAATGAAGACCATGGTTGGTTTAATCAGTCTCTGCTGATGAAGATCTTGGCTGTTA
CCTTTGTGTATAAGGAAGCTAAAGACAAGTAAATAACAGTCCAAAAACGTGTCAATTAGG
GTAAATTTTTCATTAATGTTCACTGAATTATTTAAAGTTAAGGCGTATGTAGATCAATGA
TATGAATGTGTTATGAAACTTAGATTATGGTTAGTCCAATTAAGCACAATTTTGGTTAAA
AATAAGATGAAAGACATTTTATTCATTTTTTACATCTGATTAATAATTCATCTTATTTTT
GTACTGCATTTAATTTAAGATTTATTCACTAATAAAATCTATGGCTGTACTGTTCAATGT
CTTTTCCTCTATCCACGTGTGCTGTTTATATTTAAAATGATTACAGGTACATGCACTTTT
AAATGTAATTTCTTGGTTGCATTAGCCACATTTCTAGTGCTCAGTAGCTGTATGTTGCTA
TTGGTGACTGTATTGGAGAATGCAGTTACAGTACATTTACATTGTATGCAAAGTCCTGTT
AGACAGCTCTTTAAAGAGGGAGGAACGTATGGAAAGGTGGAAGACAAGTGGAATGAGATG
GCTGGGAAGCAAGGATGTTCATTGATCTATACTTGCTTCACTGTGGGCCACTACAAAAGG
AGATCTAGTCTATTGAGAAAAGGGCTAGTCTATGCGAAAAGAGCCTGTAAACACATCTTG
GTTATATTCAAGGATATTGTTCTTGGATGCTAAAATAACAATGGGTATTGATTTTATTAC
TGCTACTGAATCAATGAATGGATCAATAAACAAAGGTATAAATGAAGGAAAAGATTGCTT
ATCCTGGATCAATGATGAGTACCCTGGGGTGTCTGAATCTTGGATTTTGATTAAACCCTA
TAACTCTGAGGTCCATTACAAAAAGAATACTTTTTATTATGTCTATGGGAAATGAGCTTA
TTCCAGAAGCTAACAATAATCAGGATTTAGTTCTTGGGCTTCTGAGTGTGGACTGTATTA
TTTTTAGTAAACAAGTACATGGATAAATCAAGAAAAGTGCAGTATAAATAAAAACAGAAT
GGTTATTCCTGTTCCAAATATGAGAGTATATAAAATAACAAGAATCATTACTAATACATT
TCTGAAGCACTAAGTCCCAGTAAAATAAATTAATCAAAGCTGATCCTTTGGGTAAGGAGC
ATTTAGATAAATGGATGTTAGAGTCCATGTTGTTGTTCTGCTTTAGGGTGTTCATTTTTT
GTTTTTTTTTTTAAAGAAAAGGGCAAAATGTTTACTTTAATTATTGCTTAAATTACTACC
TAATTGAGAGAGTTTACACATGGATCTATCTTGAGAATATGTCAAATGACCAGTTATAAT
GAATTCTAATAATCTTCACTATTTAAATTCAGTTCCTCAGTTTAATTTACGAAAACAAGG
AAAATGATCTGAATTTTCTGTTTAATGAGCATTGGACAGGCATTGATATTGTCCAGTTTC
TGTGAAGTCACAGATATAATGATTTTATTATAAATGTAAAAAGGAACAAATTAATGTCTC
AATCAATTATTTAAAATAAGGCCAAATCATGGATCAATGAGGGTCAGGTATTATGGAACA
AAAAGAGTGATTAATCCAGTTCCATACAACAGCTCTCCTGTATTGTCATTATTTCCATAA
ACAAAATTGAGGTAGGCTCTTGCATTTTTGGAATGGTGAATATGTTTATATATTTGGATA
GTATTTCCCTTTCAGTCTCGTTGGTGCAATTTCCTTAAAATACAGAATAGACAAATGCCT
CCATGTGTAACTATTTAACTTTATATGTATGTATGCACGCATACACAATTGTTGAGAATG
TACTCGAATCCAAGATGCAGATTAATTTAATTCTTTCTAGCAAGATTCATGTAGAAAGGA
GATTTAACTCTTTCCTAGTTGAGTAGAAGGCAGATAAACAGACAGACGGGTTTAATAGTC
ACAGTTCTTATTATTTTGCTTGGTTTTACTTATAGTAGTTAAATTTCATACTTGAGTCAA
CTAATCAATGAATCAATGGGTATGTCATTCATCTTTTAAATATATGACAAGCACCAGGGT
TTATTTCTAATCAATAATTGTTGACTTGAACGGAATTAAAAAAAAATCTAAATCTAGGCT
GATCCATTTCTCTCTCTCTCTCTCTTTCTCTCTCTCATCTACCGATTTTTATATTCACCT
TGTACTCCACAGAATGAATGCACAACGATTCAATTATTCTCCAGCGAGGAAGATCATGGT
TATTGTCTGTTTGAGTAATGAGTGTAGAAACCTACGTAAGTAACAAAGTGATTGCTTTTG
CTTTAGTGGTTGTTAAGAGAGTTAACTCTTTCTGGAAAGGAATAAATGACTACGTATGCA
AATAAAATAAATGAAGTTATATGTGAATCGTTCAGCACATCTATGGTCAGTTAAGAAGAG
AAAAGCAAGACCATCTTATTCATTTTAATAGTTAATTATTGAGTTAATTAATGTAAAAAT
TAATTATTCAATTTTATATGAGTCACAGTTGATTTTAACCTCCCTCTATAAAGACAGCTT
ATTCACATTCCAAGATGGAGGATATTGTCAGTGTGGAGTAAAATGGTAGGTTCATAGTTC
TTTATCATCACATCCTTAAAGTATGGACAAGGTCAATGAAAGTTGATCAAGTTTTGACCA
ATTAAGAGTATGGGATTAATATGAAGCAGATATAGTCATTAATCTGCTAATCTGAAAAAC
AATCTATCACACAAAGGGATCTATCTTCGTTCCTCTGTGAGAAATGACCTATGAAGAGAT
GTCAGGGTTGTCTGATTTCTTGTTATGGGGTTTTTGGGATTCATAGGAATTGATTATACT
GTTAGTAAATCAATGAAACATGAGATAATGTGTAAATGAATGATGATGAAGAATACTAAA
TATGGACCAATGGTGGGTTTTTGTTGGGTATGAACCAAGGATTAAGATTAGTTCAAATAT
GCAGTAGTAATGTCCATTCCCAAGAGGGATAGTGGTAAATGAGCCCATAGACAATGTGGC
AGTACTCATGGTATTTTAGTTTTAAGGTTTTGATGGGTATTGATTATATTATTATAAATG
TATCGATGATTGAATCAATGCACTAATGTAGAATGAAAGAAGAAAAGAATCTACTACGGG
TGTATAGAATGAAACAATAATTTTTTGTTTCTTCTTTACATCTTAATTTTATTTTAAGTT
CTGGGTTATATGTGCAGGATGTGCAGGTTTGTTACCTAGGGAAATGTGTGCCATGGTGGT
TTGCTGCACCTGCCAACCCATCACCTAGGTATTAAGCCCAGCATGAATTTGCTATTCCAA
AAAATATTTCTGAAACACTGACTTTCACTAGGACTTTATGAAGCATTTTATCCCTTTGGA
TGAGGAGAATATAGGCAATTTTTGTAATAGTCAATGTTCTTGTTCAGGTTATAGAGTGAA
TTCATAGTTTTTCATTTTATTAAAAGAAAAAAGCTGTTAAATAAATAAGTAAAAGATTAA
CCCACTAACTAAACTAAAGAGGGCCAAACATTGACTGTTAAGAAGCCTGGGTTCCTTTTT
ATTTAACTGCTGTTCAGATATACAAAGAATTTCAAGGCTCTGTCCACTAAGGGTATTTTA
TATGTAGACAGATGCAAACATTGTATTTTAGTTCTTAGTTGTTGGTTTTCTTAACCTGTT
CATTTTCTTTAGAAATGTGAATGATAATTAATCCATAAGGAAGTACAGACGCAAATACAT
AGATACAGATGTATACAAACTGATGTATACATAAATAAGGGATACCGTAGACCATTGATG
AAACTGTGCCGTGAAACAATCATTTAGATTAATTTCATTTAAATGCAGTTCATTTAAAGG
TAAACCTAAATTATTGTTATCTATGCGAGACGGGCATAGAGACAACTATTCATTATATAG
TTCTTTTTTTTGTATTTAGGAATGAGGTTTATTGTACTTATTAGTTTATTAAAACTTGAC
TTTGAGCTAGTCATAGGTCAGTCATAAGCTAAGGATAAAACTCTGTTACCTATCAAGAAT
TTCAGTTAGTCCAATAACACATGACATCCATAAACAGAAAGAAAAATCACAGTTGTTTCA
TTCTTTCTAACATCTCTTTTGTACTTCACAGACTGGAAGCGTGATGGCTGATCCAATCAT
TTTCCACTGATGAAGGTTTTGATGGCTACCTATGTGAGTAGGGAGGACATAGGCTGCTGT
GAGTAATTGTCTTAAATTCTTAAGTCTAATATCAAGGATTTTGTTAGTAAATTTTGATTT
TATTATTATAAAGGGATCAATGACAGAACCAATAAACAAGCATATAAACAAGTAAAAAAG
GAGACTGAAGCATTGTTCAACTATGAATAAATGTGATTAGGCAAGGAAAACTACTAATAT
AAATGGAAAACACTGAAGTCTCAAGAAATATTATGTGTCAAGCATGCTACTTTGTCTAAG
CGTCTTAAGACACTGCATATAAGAAATAGTCAATATTATTGTTCTGGATCAGTTCAAGTT
CAAGGTTGTTAATTTTATTAAAAGAAAAATATGTAAATATTATCACAGATTAATAAATAC
CTAAACTATTGTGAAAATGAAAGGGTAATACAAAGGTGACTGAAGACAAGTTATCAGTGT
TTATCTTCTGGTCTGCTTTGTACTCCTCAGAATGAACAGCCCCATCTGATTTAATCACTG
TGCAATGACTGTGAACTGTACGGTTACCTCCGTGTGTCACAGGAAGACTCTTGTGAGTAG
TAGTCAAAATTCTTGTTTTGTTTTAAGGGTATTCTCTGTATTCTTAAGAAGTCTAAAATA
TAATCAAAGAGGGTCAAGCATTTTTATTATTCACTACTTAAGTACAAATTTATTCTTAAG
AGTTCCCTATTCATAGCTATTTATTTTATGATTACAGCACTATTAATGAATTGATTAATT
GAATGAATTGATTAATTAATGAATTAATTAATTGAATGAATTGATTAATTAATCAAAACT
AATGTTTTTGATAGAGTCAATCTTGGACCAATGATGATGACTGGTGGCGTATGAGTCATT
GACGATGAATACAGGTCTGGAAGTCTGAGGTCCAATATAATAAAAAATCTAGTCTTCACC
TTCTGATCCTAAGGATAGACATTAGGAATATTTGAGGATGTTGTTCTTGGTCTTCATGTT
CATGCATTTTCCCTCTATTTTTATAATTGGATCAATGAATCAATAAGCAAATATATTTTA
ACTGCATGAAGATAAAAATAGTGAGGCATTGTCCAGTTATGGAAATATATGGTGAAATAA
GAAATACTATTCATTTATATATAAAACAATAAGGTCTTTTTTCTATTAACAAATAAATGA
CTCAAAGGTATTACTCGCTTGCTGCAGGATGGCATATACAGTAAAAATAATAATAACCTA
TGTCAGGTCATTTGGGTCAGGACCATGTTCATGGTTGTTTGTTTTCTCAAGAAAAAAATA
GTTTCACACATACTTACATGACTAATAGAATGAAAAGAGAAATGTATGGATAAATGGACA
GAATATTTCCATCTTTTTATCTTTTTTGCTTTGTACTCTCAGAATGAACACCCTCAAGTT
GACTTAAGCACTCTTCCATGGTCACGAGGTTTCTGTTTGCCTCTGTGTGGTAGAAGCTTG
GAGACCAATGTGAGTATACTCAAAGTTCTTGTCTTGGTTCTGGGTTTTTAATGGGTATTC
ATTGTTTTATTAAGAACGTTACAGATAATCCAAAAGGTTAACCATGGTCCAGTGGTAAAT
ATGGCATTGCCATGAAACATTATGTTGATTATCTAATATTAAAAAATTAAAAATGATTAA
TGATAAAATCACTGTGACAGATGATCCTATAGAGAGCTATACAGTATTTCTTGTTCTTAA
GTTTTTGTAACATTATTTAATTACTATTAGTGAAAGGATGAATTAATCAATAAACAAATG
TAAAGTAATGGAGAAAAGGAGGGCCAGTCTTCAGTCCATGATGACTGGTGGCGAATCAGC
CATGGGTAATGAATACCATGTCTGCAACTCTGCCTCTGTTGAAAATACCATACCCTATGG
GTAGATTTAAGAATACACAAGGCTCATGTTCTTGGTTTTCACACTAATGGATTTTGATTT
TATTATTATAAATAGATCAATGAAAGAATCAATAAAGCAATATAAGCACACATGAATAAT
GAAATCATCATACAATTATGAAACTATGTAGGGAAACAAGAGAAGCCATTTATATACATA
TGGAAAAAAGTCTGTTAAGAAATAAATGGTTCAAATGTGTTACCTCTAGCTAAGGATGAT
ACAGAGGATATAAATAATATAGATAGATAAAATAATTAATAAACAAATATAAATAAATCT
GAATAAGTGAAGTACTGTCCAATTATAAAAACTGTATGAGTAGATAAAAGAAACTATTCA
TATATATTGAAAACAATAGCGTCTATTATGAAATAGTCAATATACAAGGAAACGCTCTTG
ATTTGTGTCAGTGTCAAGATCATTGTTGGTTTTCTTAAAAAAAATTAATAAATATTAACT
GAATATTTTAAATGTCTAAATGATTGGCTAAATGAAAGGTGACATGCATAGATCGAGGAA
AATAATGTCTCCATTTTTATTTTCTTTATCTGCACTGCTTTGTACTTACAGGCCTTCTGC
TGTGATCGCGTTCTCCACAGTTGCCTCTGGGTAGGAGCCCGGACACTAATGGAAGTGAGA
GTCAATCTTCTTGTCATATGTTTGTATTTGTTTAGGGTAGATTTGAAAAGATTCACTATA
AATTTTTAAAATAACCAAAGAAAGCCACCCATGACCCAGTGGAAAGTATGCGGTGGACAT
GAAACATGTTGATTAATCAATATTTATAACACTGTGGATAATTAATGAAAAAAACATGGT
AAATGACTTTATAGACTGGTGTTAGGGATACTTAAGCCATCTTGTTCTCAAGGGTTTTGG
GATTTTGTTCATAAGCATTTTGGATATGTAGATATTTACTTTAATATGATTGGTTTACTG
ATAAATGAACCGGTAAAGAAATGTAGAGATGAATGAGATAAAAGAGGCCCAAGCCTGGAC
CAATGATAATGACAGTTGGGGTATGAGTCAGGGAGCTTGAATAATGGTTTGTATCTGGAA
ATCTGAGGTCCAACACAATAAAAAATTTAGTCTAATTACTCTGATGGAAATCCAAAATAA
AAGGGCAAAATCTTTGTATATTCCTAATACGTATTTGATAGCATTCTTATAAGTAAATCA
ATGATGGAAGCATTAAATTAATATATAAATCAATAAGTATGATTTATTATACTATAGATG
GTGAAGCTTTATTCAATTATCAATATATGTGGTCAGGCAAGAAATATTAATAATAAATGT
TGAAAACACTATTCCCATTAAGAAATAAGTGGATCAAAGTGTTACCCTTAATGATCATAT
AGACACTGATAAATAATAGTCAACTTTATTACTCTGGTTCAAACCAAGTGGAGGTTGTAT
GTTTTGTCTAGAAAATATATAAACTACAAAAAGTTAATAAACACCTAAGTGAATGAGTAA
ATTAAATGTGGGGAGTAAGATTCAATTAAGATAAAGTCCTAATTTTCTTTTAATCAAATG
CTCTGCTTTGTACTCCTTAGAATGGATGCACTGGAGCTGATTTAAGCATTCTTTTTGGTG
GTCACAAGATGTATAGTTGCCTCTGTATGTTTGGCGCATGGAAAAAAATACGAGTTTTTG
TGGACATACACTCTTTATTTGAAAAGTATGAAATATAATCAAAGAAAGCCAGCCATGGCC
TAGTGATAAATATGGAATTGATATGAAACATTATATTGATTAATCATCTTTGCAGATGAT
TACTAAAAGAGATAAAGTGATTCTATATAGAGATGCAGGACTATTTCAGGCTCATTCATG
ATCTAGGTTTTTGTGCTTCATGGTTATTTTATTATTATCAATAAAAAGAAAAAAGAAAAA
AATCTTAAACTGTCCAAAAAATTAGGGAGACCAGTACCCAACTTTCATGTAGGGCAGGGA
CTAGTGTCCATTTCCACCAAGCAGCCTGGAAATGCGCATCCTCACAGGGCGTTGGAGAGG
TTTCTCAAGAAGCGAGTGCCTCCATGGGGGAAATAATTCACCCCAGATTAAATGCTGCTT
CAGACCTAATGGATGGTAAAAACAAGATCCAAAAGGATCAAACTCTTTCCAGGTAGATTA
ACTGTATCCCAGAACAAAGCTCAAGGATGTTTTTAGAAATACATATATATCCAGCACACA
AGCAGGGTAAAATTCACAACATTTGCAAATTTACCAGGCATTCAAACGGGCAAAAAATAC
ACAACCCACAATTAAGAGACTAATGAATTAATCAAAACCAACTGAGAACTTATACAGATG
TGAGCATTAGCAGAAAAGGACATTGAAGTAGTTATTAGAACTGTCTCCCTGGCCGGGCGT
GGTGGCTCATGCCTGTAATCCCAGCACTCTGGGAGGCCGAGGTGGGTGGATCACCTGAGG
TCAGGAGTTCGAGAGCAGCCTGGCTAACACGGTGAAACCCCACCTCTACTAAACATGGAC
CAATGATGACCACTGGTGGCGTTTGAGTCATGGACGATGAATACTACGTGTCTGAAACTC
TGAGGTCCAACAGAAAACATAACTGGATAGATATCAGAAATGTGCAAAGATCATATTCTT
ACTTTGGATTAATAGGTTTATCATCAATAGATAAATGATAGAACAATTAAACAAGAATAA
ATAAATAGAAGGTGAATCATTGTTCAATTATGAATATACATGATGATGTAAGAAATATTA
TCACTAAAAATTTTAAACACTGGTGCCCCTTAAAGAAATGGATCATGAGTATCGTCTCTT
TGGCTAAGGTTCATCTAGACTCTAATAAGTAAGGGTCAGTTTCATTTTCTGGTTAAGTCT
CATTTGAGATTGTTCCTTTTGTTATGAGAGAAGACATTTCCATTCTGAAAAATTAATATC
AAAATAACTGAATAACGGAAATATGGAAAGGATCAATGGAGATAAGGTTTGAATTTTTTT
TAAAAGAGTTACCTGCTCTTTGTATTCTGCAGAATGGATGCACTTGAGCCGACCTAAGCA
TTCATGGTCATGAGATTTGTGGTTGCCACTGTTGGTTAGGAGCGTAGAGATCAGTGTGAG
TAATAAAGTTCATGTCTTTCTCTAAGAGACTTTTTAAAGGGTATTCATAATATCATGAAA
GTGTGAAAAATCATCCAAAAGGCCAGCCTCAGCCAATGATAAATATAAGGTTGGTTGAAA
CAGTATATTTACTAGCTCATTTATGACACATTGAGGATAATTCATGAAAGATATATCAAA
CTGACAGATTATATAGAAAGTTCTAGAATATTCTGTGCTCTTACTCTTTGGGTATTATAT
TTACATGGATTATAATATTAATATTCGTGAATTAATGCATAAATACATGTAAATGAGAAT
TAAGCTAAAGAGTCCTAAACCTGAGCCAATGATGAAAACTGGTGGTATAGAAGTCAAGGA
TGCTGAATAATGTGTGTCTAGAACTCTGAGGTTCAATAGAGGAGGAAATATAGTCTATTG
CTTTTGAAGTGATCTTAAAGTTAGGTTTTGGAAATACAAAAGGGCCATCTTCTTGGATTG
TTTTTGTGAATTTTGTTTCTTCTTTAAAATAAATTCATTGATGTAATAATCAATGTACAC
ATGTAAAAAAGTAAAGATGAAGAGTGTGAAGCATGTCCACTCAATGTAAACGGTGAGACA
ACAGAAATCATTAAAATGTATTGAAAATATGACTACGGATGACATAGGCAGTATAGTGAA
GTTTCTTATTTTGCATCAGAACAAGTGTGCTGTTGTTCATTTTTTTAAAAGAAAATTGAT
AAATATTACCACAATTAATAGATACCTGGATGACTAAGAGAAGGGTCAAATGAAGGAATC
CGTGATAAATATTTCAATCCTGTTATCTTCTCTGCTTTGCACTTCCCAGAATGGACACAC
CTGGGCTGGCAGAACATCTTTCCTTGATCTGGAGCCCCATGTCTGCCCCTCTGTAGAGGT
GCACATGGGCCAATGTGAGTTAACAGTAAAATTATTTTTTGCTTTTGCTTATTTGTTTAG
GATATTCAGTGTAATATTTAAAAATATTATATATTAATATAATCAAGGGAGGCCAGCCAT
GTCTAAGGATGCATATGGACTTGACATGAAATATTGTGTAGATTAATGGATATTTTAAAC
AATGAACATGATTGATGAAGGAAGTGTTAATATACTAATTGAAGCAAATGATTATGTAGA
CAGATACTAGGAATACTTAAGGATCTTGTCCTTAAAACTTGGTGATCCAGAGGTATTTAT
GATATTGTTAGTGAACTAATGAATCATTAGGAAACAACTTATAAATAAAAGGAGAAAAAG
AGGGCCAATTCTGGCTGGATTGATGACCACTGGTGGCCTAGGAGTCATACAATGAATACG
TGTCTAGAACTCTGAGGTCCATCACAAGCAGTATCTAGCCTAGTCCCTCTGTCTGAAAAA
CTCCTGTAGACAGATGTCAGGGAAATACAAGAACCTTGTTCTTTTTCTTTATGTTTATGA
ATTTTAAAAATATTATATTATTAAAATCGCAATGAAGAATAAACAAATGTGTATAAGTGA
ATATAGATGAGGGTGAAGTATTGTTTATTGTTGAAATGTGTAGTAAAGAGAAATAATACT
AATATAAATTGAAATGTTTGGATAATTAATGGACCAAGTGTAATACATCTTTGACTAAGG
ATCATATAGATAGTAATAAGTAATGGTTAGTGCTCTGAGTTAGTTGCAAGTTTCACATTT
GTTGTATTAAGAAAAAATTAATAAATACTCAAATGACTATGTAAATGAATGGTGAAAAAT
ATAGATTAATGTAAAGAATATTCAATTTTTTAATCATCTTCTCTGCTTTGCACTTTTCAG
GATGGATGCAATGAGCTGATCATTTTGCTGTGATCAAGGCTATGTTGCCTCTGTGTTAGG
CCAATGTGAGTAATGGTTCTTGTCTTGGTTTAGGTTGTTTAATAGTATTCCTGATATTAT
TAAAAATCATTTAATATAATAAAAAGTTAACTGGCTTAATGATAATGTGCAACATTGAGG
TTAATTAATCAAAGAGATGTAGTCTCTGTGGGAAATGATTGTATAGACAAATGTAAGGAT
TCTTCAACTATCTTGTTCTTGGGTTTTCAAAATCATGTCTTCATTTTATTATCAAAGAAG
AAATGATTTATTCAATAAACATTTAGAAATGAATGATGAAAGAGAGATCCAACTATGAAT
CAATGGTGACCACTGGTGGCAGATAAGTCATGGATGATGAATATGAGAAGAAAAGAATCT
AGGTTTTTGCTTCTGTTGGAAATGATCCTGTAGACAATGTCAGAAACATACAAAGATCAT
TTTCTTATCTTGGGGTCATAGATTTAGGTTTATTATTACTAATATATGAATGATAGAACC
ATTAAACAAATATAAACAGATAAAAATACAAGTAGAGATTTAAGGTAGAGTGTCTGGCTA
TGAATGTAGGAGATGAGGTAAATTATTACTAAAAATAGGAGATACTGATTCCTCTTATCA
AAGAAATGGATCACAGTGTTTCCTCTTTGACTAAGGATTATATAGAATCTAACAAGTAAG
AGTCAGTTTTATTTTCTTGGTCAGAGATTGTTTCTTCTGTTAAGAGAGAAAGACACCTAT
AATATGAAAAATTAGTAAATACCCAAATCACTGAATAAATGCAATGCAGAAAGGCAGGAT
CAACAGAGATTAGGTCTCAATGTTTTTAGTCTGCTCTGTACTCTTCAGAATGGACAGACC
CGAGCTGATTTTGGTGTTCTGTGGCTATGAGATCAGTGGTTGCCTCCACGTGTTAGGAAC
ATGGAGACTGACGTAATAGTCAAACTTCTTGTCTCAGTTTCAGTGTTCTTCTGAAGGGTA
TTCAGTAAGTGCAAAATGTAATCAGTGACTGCCAACCATCACCCAAATGTAAAAAATGTA
ATTATTATATATGAAGCCTTGAGGTCAGCTGATCCATAGGCAGATGTTAGAAATATTATT
ATATTTCTGCTTATTCCATAGACAGATGTTAGAAATATTCAAGAATCTTGTCTTCTAGTT
TTTGTGATTCTTGGTATTTATTTTAGTATTATTAGATTATTGATGTGTTATTCAATGATA
TGAATGAAGAAAATGAGAGCCAAGCCTGGATCAATGATGTCCACTGGTGGCGTATAAGTC
ATATATGATGAATATATGTCTGGAACTCTGAGGTCCAAGAAGGAAGGAATCTAGGTTATT
GCCTCTTTTAGAAATAATCCTATAGATTATTTAAGAATATATAAGGATCTTATTTGGCCT
TTTTAAATGAGTTTTTACTCTATCATAATAAATTGATCAATAAAACAATCAATGTATGGA
TACAAATACATAAAGGTAAATAGGGTGAAGCATCATCAAATTATGGAAAGATGTGGTGGC
AAGAGAATCCACATGTATGTACACTGAAGACACTGAATTCCATTAAAAAATCAATGGTTC
AGGCTGTTACACCTGGTTAAAAATCATGCAGGTAACATAAATAATAGCCTGGATTCTGGG
CTAATGGAAAGTTTGATGTTGTTTTTCTTAAGTTAAAGTGTCACATGTATTACCCCAAAT
CAGTATATACCTCGAACTACAAAGATCAATGGAGAGAATTTCTCAATTTTGTTTTTGTCT
GTACTACTTTGTATTTCTTAGAATGGACACACCTGAACTGACCTGTGCATTTGCAAGCTC
CATGGCTGTCCCGGTGTTTGGAGCATGGAGACCGATTTGAGTTATAGTCACTCTTCTTGC
CTTGGTTTTGGTGGCTTATTTAGGATACTCACTGAATGCTTTTTTAAAAAGTATTAAATA
CAACCGAAGAAGGCCAACTGTGGACCAATGATAAGTATGGATTCGACATGAAATATTATG
TTGATTGATCAATTTTTGTAACAATGGGAATGATTAATGAAAGAGGTATATTCAGTGACA
TACACATACGTCACTAAATGAATGATGTGATTCCATAGATAGATATTAGGGATATAAGAA
TCTCTTTTCTGTGAGATTTTGTGATTCACAGATAATTATTTTATTATGTTTGATGAATTG
AGTATTAATTAATAAGCAAATATACAGTAGTATGAAGAAAAAGATATGTAAACCTGAACC
AATGATTGATGGTTTAGGAGTCATGGGTGATGAATAATATGTGTCTGGAACCTAAAGGTT
TGCAGAAAACAAAATCTGATGTATTTCCTAGGGTCATTTGCAAATGACAATCAGTGTTTG
AAATGATAGATTGATGTTAATAATGTGTAAGAATCTACTTCTTTTATTTTGGATTCATGG
ATTTATATATTGTTATTATTTAAAACTGATCCATGATGAAAGTATTAAACAAACATATAA
TTCGACAAATATGAAGATGGAGAGATGGACTTCAACCGTGTGATGATTCAAGATATACTA
TCAACATAAAATGAAACACTAGCTCCCAACATGGTGAAACCCTGTCTCTATTAAAAATAC
AAAAAATTAAATGGACATGGTGGTGCACGCCTGTAATCCCAGCTACTTGGGAGGCTGAGG
CAGGATAATCACTTGAACTCGGGAGGTGGAGGTTGCAGTGAGCCGAGATTGCGCCATTGC
ACTCCAGCCTGGGCAACAAGAGCAAAACTCTGTCTAAGAAAAAAAAAAAAAAAAGAAATG
GACCTAAGGGTGTTACCTCTTTTTCATTAGTGATCATATAGATGCTGGGTAGTAGGAATT
TTATTGCTTGGAGCAGTCCTTTTGAGGTTGTTTTGTTCAGAATGAACATATATGTTATGA
AAAATTAATAAATACCTAAATTATTGGGAAAGCAAAGATCGACAAAAAGGTCTTAGTTTT
TAAAATCAGCTGCTTTGCTTTGTATTTCTTAGAAGGGATGCACTGGCACTGATTTAAGAA
TTCTCTCATAGTCACAAGACGTATGGTTGCCTCTGTGTAGATTCCTGGAAACCAGTGTGA
GTATGAGTCAATATTCTTGTCTTGGTTTGAGCGTTTTTTAAGAGGTATCACTGTGTTATT
ATACACTTTGGCATTTAATTAGTTAATGTCTTAAGAATGGGATTCATGTAATGCATTATG
TTGATTAATCTGTATGTGAAACACTGCATTAAATTAATAAAATATATCTAGTGTCTATGG
GAAATAATTTTGTAGACAGATATTAGATATTCAAGAATCTTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved