Pongo_pygmaeus Locus Mono:344:SNORD37
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:344:SNORD37
Pongo_pygmaeus
Mono:344:SNORD37
14
SNORD37
1001..1065
2065
ATTTCATGGTGTATATGTGCCACATTTTCTTAATCCAGTCTATCATTGATGGACATTTG
GGTTGGTTCCAGTCTTTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAATGT
ATTTTTACACACAATCCAATTTTCCTTATCCTTTGTAAAGTTTGAGTAGCTCTGCTTAAA
CCCTATCATGGAGAAGAAGACATGATGAGATAGTCATTTTTCTGCTCAAAAAGGGTTATG
TGTTTGGTCAGCAAAACAGAAAGAGAATTGGAGGGACATAACTGATGTAGAGATAACTGT
TTTTCCCTGAGAAGGGTCCAGAACTCCAGCTGGGCTGAAAGGAACAGTTTGTGGCCAGTT
GCGGTGGCTCACACCTGTAATCCCAGCACTTTAGGAAGCCAAGTGGGGTGGATCACTTGA
ACACAGCCTAGGCAACATGGTGAGACCCCATCTCTACCAAAAAATACAAAAACTAGCCAG
GTACCGTGGTGCATGCTTGTAGTCCCAGCTACTTGGGAAGCTGAGGTGGGAGGATCGCTT
GACACTGGGAGGTCAAGGCTGCAGTGAGCTGAGATTGCACCACATCACTCCAGCCTGGGC
AACAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAGAGTTCATGATAAGTAACATT
TCTTCAATTTGACCTGATGTGTATTGAAGAAAACCAGCATCTGAGGCCCATGGAGAAAGA
AAAAGAATAAACTTGGACAAAGAAACAGACGTGCATAAAGGGAAGACAATGGAAAGAGAC
ACAAGGAGTAAATGGCCATCTACAAGAAGAGAGGCTTGGACAGATTCTCTCTGCTCAGCC
CTCAGAGGGAACCAACCCTACTGACACTTTGATTTCAGACTTCTAGCCCCTGGTGTCATG
CAGAAATGGGATTTAGTTACGAAGTTTACAGTTTTCCAGAGGAAAGACAGCTTGGAAAGT
CAGACCCCAGTTCTTTGTGTTCTAGAATCCTTTCAAATTTACTCAGGATTTTCACTGCTC
TTTCTATTACCTAAGGACATCAGTGGTGAATATGGCAGGCTAGAGACTGACTTCCAAGAC
CAGGTGACAAGCGCTATACATCAGCTAAATGAAGACAGGAGCACAAATGGCATACAAATG
CAATATCCCCCAGATGCCTGGAGCATACACATCCTGCTTCTGTTTCCTGTGGGGCAGAAA
GGTGAATCAGGGAGGGAATCTTGAATCGACCGAGCACTAGTTTCCAAAATACTGCTTCTC
ATAACGAAAGTGACGGAGTGATCTTGGATTGACAAGCACTCATCCTCAGCAAAATCTGAG
TTTGAGAAAGTATGCAGGTATAAAGAAACAAAGGAAGACATATTTTTTACATAGCTAAGT
TTATAACAGTATAAATACTGTATGATTTTCATTTCAGTAAATGTGCTGAATGTGCTTGGC
ACTTAATTAAGAGTTGGGAATACAGTGATGCATGTCTCTCACATATTGACTCATGACTGG
TGCCAAAGCAGTTTAAGGCACATTCCATGCATCATCACCATCCCACACATCAGATCTACA
CATAAGTTTCATTATCAATCCTCAGCAAATTAACAAACTGAGGATTACCAAGATTTTGCC
AAGGTCACATCATTGCTGATTGGTTGGCAGGGATCAAACCCAGGTCCACTCAACTCTGCT
GCCTGCCTTTTATTCACAAGGCCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved