Pongo_pygmaeus Locus Mono:209:SNORD38
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:209:SNORD38
Pongo_pygmaeus
Mono:209:SNORD38
8
SNORD38
1001..1069
2069
AACAAAGTTGGAAGTAAAAGTCAAACAAACACTAAAAATACTCTCTATTTTAAATTACA
CAGCTGTTCTAACAAATACTCACCTGTACCCCCTAAATATGTGAAGTATTATATATCAAC
AAAAAAAGCAACATGAAAATAAATTATACAGCCATTATCTCTAAAACTGATAATCCTGTA
AATGCCAAAATAGGGACACATTACTTCTCTTAGTTAAAGCAAAGCACTTAGTTCAGTTTC
TTAAGTATAAATAAGGAAAATGCCCTCATGTGATCCTGTACACGGAAATTAATACTATTC
CCTTCTAAAGCATGCCAGGACCTGGAGGTTTTCCTTAAAAGGACCTGGAGGTTTTCTCTT
AAAGTGCAGTATAGGTTATCTCAAATTCTAGAAAGCAAAGCAATTTTATTAGCCAACAAA
GCCAAAACTTTAGAGCCGCAGCCCATTAAAGTAATCTGAAAAGTTCTCAAGAGCCTGATA
GGCAGTACAGATTCACTCAAAAAATTCAGCATAAGCAAGTCATCAGCAAGAACAAGAAAA
GAAAATCATTAATAAAAGATAAAGTTAAAGGCAGTCACATTTGCTACATTTAGCTTCTGT
TGGTATTCTGGTGGTATAAAGTTTAAGGGAAAAAAACCATTTTAGTTTTGAAATCATTAT
TTAAGTAAAATCAATACAAACAAATTGTAGTTTATATTTCCTTCATTAAATGCTCACTTC
TCATATCCTTTTCATGGAAAAGAAGAAAAATTGTCACCAATCTTACCCTTTCCTTGTCTA
CGACAATGAACAGCTCCACATACCGGGTCTGTGGCAAGACAGCTCTTCTTCTCTGTCAAA
AACACAAACATCATAAAGGCAAAAGGAAGTTATAAGGCTATGATCACATCCTAATCTCTC
ATCACTTATTTCATGTCTGCTAAGAACATCATAAAATTATTTTACTTAACATATCCTACA
TCAAGAAAGTGAAAAATATGTTTTTTGAAGTGTTATCTGCTTCTTAGTGATGAAAACTTT
GTCCAGTTCTGCTAATGACTTTAAATGATGATAAACTATGTCTGAGGGGAAAAAAGTGTT
TTTGAAGTGTTATCTGCTATCTGCACTAATATGAGAAAAATGCTAGTTACAGATAAAATG
GGTTTAAGTTTACAAAGCAGAATTACCAATTTTCTAAAATCAAAACTACACACACACACA
CACACACACACACACACACACATGCAAACACACACATATTTTAATGAAAAACCCCATTAC
TATGCTGAGAGATAAAGAAAACATATCCACTAATATCCCAGAGCAGAAGTTAGAATAAGG
TTGCCATTTTAAAAAATGACTAGTTTTGTCATTTTACAGAAATTCATGTGAAGTAGAATA
AGCAAAAATTTTAATGTTTTCCAATGTTTAAAGTTAAAAAGAATAGTCCAAGTCAAAAGA
GTGGATAGCAGTAGAGGCAATAAAAATAATGCCATAAACTAGTATAAGTTAATTAAAAAT
ATGCCTCTTTCAAGGCAGCAACATAATCTCATATGTAGAAAGGTACAATCCCTGCAGCTG
AAGTTGATCTAGTCCTAGAACCATTTCAATCTAAGAGACACCCATGTCAAGAGTAAATCA
TGAAGTGCTATAGCAGTCTCCAAAGAGGAACTCAAACATAGTTTATCATCACTTAAAGTC
ATTAGCAGAGTGTCCCTGAAACACATCTGAAGTCATTAAGTTCCTAAAGCCATATCTCTC
TCTTTTTCCAATCTAGGGTTCAAGAATCACCATTTGAGTTGTCTAAGAGGTACCTAAATA
AAAACTCTATTGCACTGGGCGCAGTGGCTTATGCCTGTAATCCCAGCACTTTGGGAAGCT
GAGGCGGGAGGACTGCTTGATGCCAGGGGTTCAAGACCAGCCTGGGTAATGTAATGAGAC
CTCATCTCTACAAAAAGTTTTTTTAAATTAGCCAGGCACGGTGGGTGGCACAGACCTGTA
GCAGTAGCTACTGGGATGCTAAGGCAGGAGGACTGCTTGAGCTCAAGAGGTCAAGGCCAC
AGTGAACACTGTTGCAGATTTAAGTCCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved