Pongo_pygmaeus Locus Mono:99:SNORA71
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:99:SNORA71
Pongo_pygmaeus
Mono:99:SNORA71
10
SNORA71
1001..1118
2118
CCCAAACTCTGGAGTGCTGTGTGGTCTTGAACAAGCGCCCTTTTCTCTCTGTGATCCCA
TTCTTCTATTTGTAAAATGAGGGGATTGGACAAATCCGTCAGTTTCCAAATTCTTATTTG
TGGAACCCTGGGGCTCACTGGCAGGGATGGGGAGAGGGAAGGGGGTAGGCAGGGGTGAGA
CTCACCTCTTTTACTCCAACCACAGTGGCTTTTCTTTCATTAGTTCTACATTCAGCTTTC
TAAGGTAGGTTATACATGAAGAACAGTTTTCTGCTACCAGAAGCACTGAACCCCCACTGG
GCTCCAAGATCACTTAGAGTCTCTGGTGTTTGTATGATAAAAGTACTAGGTTTGGAAAAC
CAGATTTTGCTACGTCCTTTAACAAGTGTCTCTTTCGTAACTAGCTTTATTGTGCTGAAT
TTGATCTCTCCAGAAAAATAGTCGCATCTGTGCAGACAGGGAGTGCGACTTGAGGGAGTG
TGAGGACGTCATGGAGTCAGACACAGAGGGGCAAGAACAGCTCTTGCAAAGCAGAGACCA
GGGGCCAACTGCCCACAGCCGGCCTCCCCAGGCCCAGTGGGGCTCCAAGTCTTCGGGAAT
GCCCCAAGCAGTGGGTGGCTGTCCTCCCTGTGTTGAAACAACAGAGCTGTTTTCTTCTGG
GTCCCCCGCCCCCCTTGGCTGTCAGCTCTGAGCGGGGTGCACAGCCTCCTGGCTCCTATC
CACATGGAGCCTGGTCATCTCCTTCTGGCGTCCATCAACTGCCTGAGCTGTCAGTGGAGG
CTGCTGCGGCCTCTCCGTTGCTGACCTCTTGTTCCCCAGCCTCTTGAAAACTCTCTGTAA
TTTGTCTCTGATCCTGCTGCAGTCTCCCTGCCTTTCCCTGAGGTCGGGGCCTCAGGCTCT
CAAGACTGTAAGGCTCGCTGTCTCCGCTGTCTCATTTGCCAGGCACTTCAAGCCCCAAGA
CTCCCCTCCTTCCTCACCTTTAGGTCTTTGAAATTTTGCGCCCCTATATTCGAAAGTGAT
CCTGGTCATTGAAAGTGCAGGGAGAAAAACTGCTGAAAGCATTTCTCCTTGTTTGGAGGG
TCCACTCCTGTCCCTTCTAAACTCTGGAGTTTTTCCACACCTCCTCCTTTCTGTCACCTT
TTAGATGCCTCCTGATACGTGGTGTCTTGCTTATGGTGTGCTCCCTGTGTGAGGCTCAGT
GCTGGTGTCTGTGAGGCTTTAACCAAGGTATACATTGAAAAAAAAAAAAAGAAGAAGAAA
TAAAAGAAACTTTTTTCTGTCTGACTTTCTATGTGTGTCAGCCCAGGCCTGGGGAACTGT
GAGGGCAGGCTGGGTGAGTTTGCAAATCTTGTCATCCCAGAACCCCAGAAACTTCACTAC
CCTAGTGCTCCCTGCACACCCAAGCCATGCTGGCCAGATGTGTCTCTCTGGTCTCTCTCT
ATTGGACTCCAGCCCAGCCTATTCTCCTTGGCAACAGCTCCTGGCATGCTCTGAAGAAGG
GGCAGCTATTTCAAACCAGGCTGAGGGCCCTGGATGTGGCCATTTAAAGAAAAGGTGGTG
GTAGCTGTCTTCCCAGGCAGCACCACCGCGGTCTCACAGAGCACCTGGCAACCCACTTCA
GAGTCCACACATTGCCTGCAAGGAGTGCTGTTTTTCAGTTCCTTCTCAAAACTTTACCTT
GGGGCAGTGGCTGGGTCGGAGGCTAAGGCCGTCTTGGGGGATCCTTTGCCCAAGTGCAGT
TCCTCCCACTGAGCCACACTGTAACCTCTGACAGAGTCTGCCCAGGCTGGGGCTGGCGGG
TCACCTATTTATTTTAATAGGGCAATCCCTTTTGGGATGACTGTAAGCAGAGGCCCCAAG
TGAAAGACATTTGAAAACAAGCTGCCTGGAAACAAGCCTCTTGGAGGACCATAGGGGGGT
GGATTCTGGAGTCTTCTCTTAACGTGCATCCATGCCTCCCCCACCTCCATTCACGTTGGC
CTAGTCCATGGCCCTCCGTTCCTACTTGAGAACAGCCTTCCAGACTCCTGGAGGCCTGGG
CATGGGACGTGCCACAGGTGGCCCTAGAACCCAGGTCTCTGAGTCTCAGTTCACTTCTCA
TCACTCCTGCTGAAGCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved