Pongo_pygmaeus Locus Mono:251:SNORA72
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:251:SNORA72
Pongo_pygmaeus
Mono:251:SNORA72
3
SNORA72
1001..1130
2130
ATGATGAAACCCCATCTCTACTAAAAATACAAAAACAAAATTAGCCAGGCATGGTGGCG
TGTGCCTATAGTCCCAACTACTCGGGAGGCTGAGGCGGGAGAATGGGGTGAACTTGGCAG
GCGCTCTGCACTCCAGCCTGGGCGACAGAGCAAGACTCAGTCTCAAAAAATAATAATAAT
AATAATTCTCTCAGCCTGGCCAACATGGTGAAACCCCATCTCTACCAAAAGATACAAAAA
TGAGCCAGGTGTGGTGGCACATGCCTGTAGTCCCAAGTGCTCGGGAGGCTGAGGTGGGAG
AATCACTTGAACCCAGGAGGCGGAGGCTGCAGTGAGCCAAACCAAGATTGCACCACTGCA
CTCCAGCCTGGGCAACAGAGTGAGACCCTATCTCAAAAATGTTAAAGAAAGAATTCTCAA
AACTCAGAAGGAAACAACCCAATTTAAAAGTGGGCAAAAAACATGAACAGTTATTTCAAC
AAAAAAGATACACAGATGTCAAATGAAGACAATATGTTCAACATCATTAGTCATTATGAA
AATGAAAACTGAAACCACAATGAAAGATTCTATTTTTCCAATATTTCTCAAATCTATCCT
CTTATCAACACTGATACTATCCTAAAAAGTTCGGATCTTCAAAATCTCTCACGACTGCCG
AAATAGCCTCCAAATTGTTATCGATTCCCCAATTTCCCCTCTTGAATTCCTCCTTCAAAG
TGAACCAAGTTATCTTTCTGAAATGCAAGTCAGATATTATTGATCTCTCGTCTCATAAAA
AAATTATTCTATAGCTTAGATAATACAGCACACCATGCAAAGGCCTCTCTAGATTGTTAT
AGGCCATCTCATCTCAACTCTCACTGTATCCATATGCCTACTACACCCTTGCTATTGATA
ATACAGAATGATCACTTGTATTGTTTACTCAGTCTCAAAGAGACTTCTCATCTATATCCT
CTACTTGTACCAATCATATTCATACTTTAAAATTCACTCCATTGTGAATATTCTCACTGT
TTTGATTTTATAATATAACAACAAGCTAAACATTCACTATATTAAAACCACGCATGTGTC
TCGGACCCACCTCTTTCCCTAGGTTTGTTTTTATAAATGCTGGTGATAAACCAGCTCTGA
CTTATATGATCATTTTGTATGACCATCTAAGGGCTGTGATTCTAGGTTACCTTTAGTCAA
CTTTAAGGAAAATGACAGTACAGCTAATCTAATAACTTTTGCAAATAATCAGTGCTAACT
TGGAAACTTCTGTCAAAAAAGGGCATTACCAAAGGAAGGAAACTTCATGTGTACCAGTTG
CTATTGAATAAACTGTAAAATTACTGTGTTTTTCTAGAAAAAAAGTTCACTTCAATCCTT
ACCTTCTGTATGAAGCTTTTTCTGATGCACAACACACAGAAAATTCCAGCCCAATGCCTT
CCCTAAACTAAAGGAGTAGTAAAACTCTCACTTTACAAATCTAATACCTTAACTCCTTTA
TTATGCTGATACCTTCCATTTGGTAATTATAATTGTGTATATTTTATCTCCTAGTATAAA
GTTCTTTAAAACAAAAAAAAATCTTTAACACTTAGCACAGTACTTTATATTAATTAGGCA
TCCAAGTAGTATGTGGAATAAATAAAGAAGCCTCTGGATATTCATTTAATGTTGAGGATA
AGTTATAATTAAGTTATTCCAAATCCTATACCCCCCCAAAAGGAAAGTATCAGTCCTAAA
ACAAAGTTCTTTAACAAGAATATTATCATGGGCTTGGTGCAGTGGCTCAGGCCTGTAATT
ACAACACTTTGGGAGGCTGAGGCAGGAGGATCGCTTGAGCACAGGAGTTTGAGAGCAGCC
TGGGCAACATAGCAAGACTCCGTCTGTACAAAAAACAAAAAAAAATTTTAAAGAGAGAAT
ACTATCATGAATTTAGGCCATAATCTTTTAAACAAACATTTGATGAGTTTATACTAAGCA
AAGTGGTATGAAACTTTCTCCAGTCTAATAATTTCATGAGCTTTTTTAAAAGGAGTTTTA
GCGAATTTAATTGATATGCAAATTAGAATTCTGAAACTTCAATGCGTTTTACCACGGCTT
GAAAGGATTTACATTTCTAAGCAATAAATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved