Pongo_pygmaeus Locus Mono:267:SNORD60
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:267:SNORD60
Pongo_pygmaeus
Mono:267:SNORD60
16
SNORD60
1001..1083
2083
CGGGGAATGCAGGAAGAAGGAATGAGTAAAGAACGCGCGAGAAAAGGACGGAGCGAGGG
ACGGACTACTGACAGGCGGACGGACAGCGACGCGGACCTCGACCCCGACCGTCTCAGCCC
CGCCCCCCACCCCCGCCCCGGCCCGACTCCTCGCCTCGCCTCGCCTCGATCTCGACGCGC
CCGATCCCTCCCCACCGCGCGGTCCCCAGGCGGGAGCCCCGGGCCGGGCGCGCCGCGGGG
ACACTCACCCGCCCGCGGCCGCCCAGGAGCGGCAGCGCCGCCAGCCCGCTTCATGATGCC
CCCTCGGCCGCCGGCCGGGAAAGGGACTAGGCGCGCGAGCCGGAAGCGCTAGACCGCTGC
GCCCGCCGGGAGGTGTAGTTCCCCGCCTCTCAGGGCCCGGGCGGCTGCCTCACGCGCGGC
ATTTCCGAAACTACGACTTCCGGCGGCCTTGTCGTCGCGGGGCGGGATTGGCAGCTTCAG
AATCACTCTATGTTGCAGATCGAAGACTGATTGGCTTTGTTCATCCGTCACTCACCGTTA
GGCTTCGCGGACTCTGCATAAGGGAGGAGCTGCGGGTCCGGGTCCGAGAGACCGCCTCCA
AAAGAAATGCCACGGTACGATTGGTGGAAACAACGCGGCAGGGAGCGGAGCGTACCAGCG
GCAAGGGAAGGCGGGCACTTCCGCCAGGATAGCCCAATGACAGAGGTGGGAGAGTTTCTA
TAAAAGCTTGAGCCTCGCCTGCTTCCGTCTTTTTGGGGTCGAGTCCGAGGCGGAAGAGGT
TTGTTAATGCGTTCGCCATGTGCTACGATCCTGGGACGAACTGGGCCACGAGCGTGGCGT
TGAGGGCGGTCCGAACGCTGCAGGCCGGCCAGGTCCCCGGGCGTCCCGGCCTGGCCTACG
CTCCACTTTGTCCCTTAGCGTTTAAACGTTTCTTCCCGAATCGCAGGCCCCCAGCTACCT
GCAGGTAAGACTCGGCCGGGCCTGGGTTCCCTTATTCTCCCAGTCTGTGATGAATTGCTT
TGACTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCTGATTATTTTGCAAGACTGAG
GCTTGAGGGTGCGCACTCCTGACGGGGGGCTGAGAGTGGAAACAGGTGTTGCCCGAAACG
AAGGAGTGGGGACTTATGTCTACATTTTGGCGGTGACTTTCAGGTTTCGTCGCGAGCCGG
CTGCAAATTTTGAACCTAAGTAAACCTCAATCCGGAGGGCCTAGCGGTAAGGTGGGCGCT
GTGTCTGTTGAAGTGCTTAGCAATAAAGCAAAGGTAGTGAGTTGATTCGGTTTTCTCTCA
AGTGTCTTTATTTTCCTGTTTTTCTGGCACCCCAGAGGTCTGGCTGATCCACAGGCAATC
TTGGAAAAGGGTAGAGACATGAAAACGGAAGCTCGTTACCAGTGACTTTTCATCTCTTGG
GATTGTCTTCTCCATTTCTGCCCGTGATTTATTTTTTTTTTTTTTGAGACGGAGTTTTGC
TCGTTTCCCAGGCGGGAGTGCGATGGCACGACCTCCGCCTCAAGCGATTTTCCTGCCTGA
GCCTCCCAAGTAGCTGGGATTACAGGCGCCCACCACCACGCCCGGCTAATTTTGTATTTT
TAGTAGAGACGAGGTTTCTCCGCGTTAGGCTGTTCTCAAACTCCTGACCTCAGGTGATCT
GCCCACTTCAGCCTCCCAAAGTGCTGGGATTACAGTTGTGAGCCACCACGCCCAGCCAAA
TACTGTTTTTCATGCCTTTTGCCCCAGGGTGAGTCCAAAAAGGCTTTTGAGATTTGTGGA
GGGAAGTTGATACCACCTAGGGTTCCCATGTGCCTTCCTAGGGAGGCAGCCACACACCTG
CCGAGGGTTCTGGGCCTTGCTGAGTCTCTCAAACTCCAGCATCCTGCTCTAGAAGTGGAT
TTTTTCCAACAGATGAGACAGAGGCTCCAGAAAACACAACTTTATTCACTAGGACTGAAA
ACAAAGGCTTGCAATCAAAAGGCCAAGTTGAGTGCAAGGTGGAGCGTGCTCGGAAATTAC
AGACCTCAGCTGTGGCCAGGCCAGGCTGGCAGTTGTTGTTTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved