Pongo_pygmaeus Locus Mono:246:SNORD14
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:246:SNORD14
Pongo_pygmaeus
Mono:246:SNORD14
3
SNORD14
1001..1091
2091
GAGAAAGGGAAGGATGGAAGAGATGTTTCTGACATCCAAGGACTGGGGTCACTGAACAA
AGCCAGAACCATCATGGGACTGTTTGGGGATAAAGCCTTTGCCAGAAAGACTTCTGAGGC
AGACATGGAAAGGGAGAAACACTTTGCCCTTCCTCTTGCCCTGTAATCTCTCACTGATGC
CTTCTGTTGACTGAATTTCACTGAAGCCAGCTGACATGGGAGCCTGGGAAGCAGCCTAGA
GGAGTGAGCCCTGTGCTACAGAGCAGAGCAGAGCACAACAAGGACAAAATGTAGAGCCAA
GGGCAAAGGAAATCCCTCCCATGAGTTATAACCTTATAACTTATGGCTGAACTTTTTTTT
TTTTTTTTTTTGAGACAGGTTCTCGATCTGTCACCCAGACTGGAATGAAATGGCAAGAAT
ACTTCTCACTGCAGCCTCGACCTCCTAGGCTCAAGTGATCCTCATACCTCAGCCTCCCAA
AGTGTTGAGATTACAGGTGTGAGCCACCACACCCGCCCCCACCTACCTTTAAAAACCCTT
ACTTGCAAGCCATCAAGAAGGTTGGATCTTAAGCATGAGCTGCCCAATTCTCCTTGCTTG
GTGCCCTACAGATAAACACTCCTTTCTCTCACCACAAACCCTGGTGTGGGTATTTGGCCT
TACTGTGCCAGGTGAAGGGACCCTAGTTCAGTTAGACAACATAAATATTTGCAGTGCATG
TGTACTACCCAAGTACATGACTTCATTGACAAATACGTATAATCCCAGGGCTTTGGGAGG
CCAAGGCAGGTCAAACAAAATTTACCAGACTTGGGTCCAACAGTTACTACCACACTTTAA
GTTAGCAAATAGCTTTCCCTTGGAAGCTTGATTTGAACAGCCAGTGAAAGAGAAGCACAG
CTGGGCCAGGGGCTTGATGTCCCTGGGTATGTTACTGCTTTGGAAAAAGGGGCAGAAATT
TATGCTTTTGCACCTTTGTAGTATTTCTTGGTAACAGAGTGTTCCTGTGATGAATCAGTT
GCAAAACCATTTGTAGTTTCCATCTAAATCTTGATTATGGGAATAATAACACCTTGATTT
AACCCTCAGGGACCTAGAAAGAGTCACATCTAGAGTCCAAGAACTCTTTTCAAGTTCTAG
TTCTAATACTTACTAGCTGAGCAAGTTGATCTACTGATTTACTTTTCGGAAATCAAAAAA
AGCCCCAGTTTCCTTATCTATAAAATGGGTATGAATATCCGTATCACAGGAATGTTAAGG
ATAAAAAGAGAAATAATTGTACAAACTCTGTATGAAACCACCAAAGGCCATACAAAAGTA
AAGACTAACACCCCGATATAGTGAGGAATTATATTTTAAAGTTGTGTGCTTACAGATATT
GTAGTGCTTACTACGCATCGGACACATATACAAATCAATGGAAATACAATATTGATAATA
TTTAAAGGCAGAATTTGGAGATTACAGTTAGAGTGGTGGCAAGGGGATTCGTGCCAAGAG
ATTGTCCCCAAAGTGTAATAGAAGATTTGAAAGATGTTAGTACAGTCTTTTTTTTTTTTT
TTTTTTTTTGAGATAGAGTCTCGCTCTGTCGCCAGGCTGGAGCGCAGTGGCACGATCTTG
GCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTA
GTTGGGACTATAGGTGCACGCCCCCACACCTAGCTAATTTTTGTATTTTTAGTAGAGACA
GGGTTTCGCCATGTTGGCCAGGATGGTCTCAATCTCTTGACCTCGTGATCCGCCTGCCTT
GGCCTCCCAAAGTGCTAGTAGTACAGTCTTTGGCAGTCAAAAAAGTCTTCTTGGGAAAAT
GACACTCGTCCTTCCTTGGAAGGTGATGGCATTGGCTACACAAGAGAGTGTGTGGCCGGG
CGCAGTGGCTCACGCCTGTAATCTCAGCACTTTGGGAAGCCAAGGCAGGTGGATCACCTG
AGGTCAGAAATTCGAGACCAGCCTGGGCACATGGTGAGACCCCATCTCCATTAAAAATAC
AAAAATTAGCCAGGCATGATGGTGCACACCTGTAGTCCCAGCTACTCAGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved