Pongo_pygmaeus Locus Poly:20:SNORA3
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:20:SNORA3
Pongo_pygmaeus
Poly:20:SNORA3
11
SNORA3, SNORA3
1001..1130, 2209..2339
3339
GGGGCCACGTGAGCCACGGCCACGGCCGCATAGGTAAGTGCCGCCTTCCCCTCGGGATG
GGCCTTGGGCTCCCTTCGGGTGCTTAGCTAGTCTGGAGATCGGTAACCTATAAGTGGATT
AGAATAAGACCTTTTTGTGGTCAAGTTGGACAGCTGTTGATTTTTTTCTGAGGATCCTCT
ATTATTCCAGTTCTAAGGAATTTCACATCAGTGGGGTAATAGGAATTGAGCAGGCACTGT
ATTTGGTTAGTTGAAGACATGGAGTACTGTGGGAATGCTGTGATGTGGAACCTGAAAAGA
TGTTTCACCCGGAATCCTAAAGTAATCGCATTGCTGAAAACAGGCATCGGTAGGGTGGGA
GCAGCGTAAGCCGGACACAGAAGTCTGGGGAAACACTCTGCTTTTGTGCGAGGAAGTATT
GAGACGCGTGAGAAGGCTGTGTGGTGCATGTAGCTTTTTTTTTTTTTTTTTTTTGTGAGA
CTGATCACTGTCGCCCAGGCTGGAGTGCAGTGGCGAAATCTCGGCTCACTGCAACCCCTG
CCTCCCGGGCTCAAGCGATTCTCCTGCCTCAGCCTGCCGAGTAGCTGGTATTACAGGTGT
GCGCCACGACGCCCGGCTAATTCTTTATCTATTTTTAGTAGAGTCGGGGGTTTCTCCGTG
TTGGCCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCACCCGCCTCGTCCTCCTAAA
GTGCTGGGATTACAGGCATGAGCCATCACACCGGCCTCATGTAGCTTTGTATTCCTGCAG
GCAAGCACCGGAAGCATCCCGGCGGCCGCGGTAATGCTGGTGGTCTGCATCACCACCGGA
TCAACTTTGACAAATAGTAAGTGTCCTTGGACTGCTTTTATTGACACAGCTTGGGAGGCA
GGGGCAGAGAGAGGGCTGGCTTAAACAAAAAGTTTAGAAGCAAGCCTTGCCTATTGCTGT
TTTTTACCAAGTTAACATTTGGTGTGAACTGAGAACCTGTCATCGAGGCTAGAGTCACGC
TTGGGTATCGGCTATTGCCTGAGTGTGCTAGAGTCCTCGGAGAGTAACTGCTGACCTTAT
TCACTGGCTGTGGGCCTTATGGCACAGTCAGTCACCAGGTTAGAGACATGCTTCACATTC
ACCTACCCATAAACTAGTGGATGATAAATTTTGGCTATTCGGAAGATGTTTATTATAGGA
GTATGTAGATTTTCCATAGAGTGCTGTTATGTGACTTGAGTTTTAGTCTCGGCCCTGCCT
CTGACATTGTCAGTGGTTTATCCTGGTTCCAGGAAATAAGACTAGCCTTTTCCTCATGAT
AGTCTTTGGTGGTTTTTAAAACAGTTGTTTAAGTCAACAGATGTATCATGTGCCTGACAC
TGCTCTATACCAGTGAATAATTTACACTGTAATAGGGGGAGGTAACTATAAAGATGATAA
ACATAGCATCTTAATTGGAGTGTGTATGAAGGTGGTTGTTATCTCTTCCTAGCCACCCAG
GCTACTTTGGGAAAGTTGGTATGAAGCATTACCACTTAAAGAGGAACCAGAGCTTCTGCC
CAACTGTCAACCTTGACAAATTGTGGACTTTGGTCAGTGAACAGACACGGGTGAATGCTG
CTAAAAACAAGACTGGGGCTGCTCCCATCATTGATGTGGTGCGATCGGTAAGTTAATTGG
ATGTTTTTCTATACTTCCATACCTTCCCTTACAAAACTGGCTTAATCTAATCCACTTATA
TAACCTGTACTTCCCAGTTACCTACCAGACATTGATATTCTTCCTGTGGTAGAATAATAA
TAGGTAGTTCCCTATCCGTAGCAGTGCCTACTGTCACTGCCCAGGTTGTATCAGGTTTGC
ATTTCGTGCTTGAACTATAGCTGGTTTTCATCGAGCACAGCTCTTGGCCCTTCATGTTCT
CCAGATAATAGAATCCTAATGTGTTCCATTGATACTCAGTGCCGTACATTATCTGAAGAG
ATTTTCCCCCAAAACATGTATTATGTCTGTCCTTACGGGGGTTCTGGTCCCTGTGTCAGT
CTTAACTCTCATGAATATGGAGGTAGTGTTAAGAGGCCAGAACCCTAGGGACGCTTTAAA
TTCACTTCCCAGCCTATTTAATGTCCATTGAGTAGTTCTGGTGGTCAGGAAGGTGGTTGT
CTTCTTTTGCTTAGCAGGGGATATTTGAGCAGGAGGAGGCTTATGCTTTGCCGAGACTAG
AGTCACATCCTGACACAACTCTTGTCCTGGTGTGCTAGAGTACTCGAAGAGAATCTACTG
GTCTTGATTCACTGGTGGGGGCAGTCGGTGCCCCCATTAGTGCCCAGATCAGAAACATAC
ATACCCTGCCTAGGGATTTAGAAAGTGGGTTGGCAGTCTTTCCTCATGCCCATCACGCAG
TTGGTACCTACTACAGTGTATTGTAAACTTTTTTTCTCTGTTCTTCTAGGGGTACTACAA
AGTTCTGGGAAAGGGAAAGCTCCCAAATTCAAGGCTGTCATCGTGAAGGCCAAATTCTTC
AGCGAGAAGAGCTGAGGAGAAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTAAACGGAGTCTCTCTGCCAGTCTG
GAGTGCAGTGGCACAATCTCGGCTCACTGCAGCTCCGCCTCCCAGGTTCAAGTGATTCTC
CTCCCTCAGCTTCCTGACTAACTGGGATTACAGGCACCCGCCACCATGCCCAGCTAATTT
TTGTATTTTCAGTAGAGATGAGGTTTCACCATGTTGGCCATGCTGGTCTCTAACTCCTAA
CCTCAAGTGATCTGCCCACCTCGGCCTCCAAAAGTTCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved