Pongo_pygmaeus Locus Mono:96:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:96:SNORD115
Pongo_pygmaeus
Mono:96:SNORD115
10
SNORD115
1001..1076
2076
TGGGCATGCGAACCTGCTTTAGGAGAAGGGGTAAAACCGTGTGCCTGGGAGAGGCTGAG
GGAGGTCACTGTCATAGCATGTCGTGGAACATGGTCATGTCATGGTACACATCACACCAT
GCCATGGTGCACATGACATCGGACCATGGTACGTGCCATGTCGTGTCATGGTACAAGGGT
GGTGGCTGGAGGAGACCTGAAGGATCTATGAGTGAGCCATTGCGATGCTGACACCCCACA
GTGGTATCACTGGAACAAGTGAATCAGGCCCGGGCGGACCCTGGTAAGACTGGAGCCGAA
GGGGCCTTTCTGATCACCTGGTCTTCATGTAATGAAATGTTAGTGACTCCTATAGAATAC
TCAAGGTCACAAAGCTTGTGGCGTGGAAGTGCCAGGCTGAAAATCCACATGCTCTGACTC
TCCCCAGGACAACTCCCACATTCGTGATCAGCCTGACCAGCCCATATGGATGTCGCTGGT
AAAGGGGCCAGCCTGACCCCAGAAGGAGACGTCAGGTGAGTTGCAGTTGTCTTTCATAAA
CCTTATATGATTTCTAAGTCTAGTTTTGATCCCACAGACCTTGCTCGAAACCAGGGCCGC
CCCCAGATATGAGTAACTAGGGCATAGCTAAGGCCATAAGGCTCAGACAGAAGTCAGTGT
CCCTGGTGGGGTGTGGGTGTTGTGTATAAAAAGAAGCAATTGATTATTATTTTTCCTTTT
CTTCCTAATTCTCCCACCTTACTGGAGAGGAATAAGATATGGATGTGGCTACTTTGAAGT
GTGTAGGAAGCAATGACTCATTAATTCTATTTCTAAAAATGCACACAAGGAAATTACTAG
GAATGAACTCAAGGGTGTTTACCATTTGTATACTGATACCACCCAATTGTCTGGCACTGA
AGATGTGGCATCCAGTCCACTTTACCACCAGTGTTTAAGGAAACCATCTCTGTTAAGCAT
ATTTGATCTAAGTGTGCATATGCACATGAGTGCCATGGGTTAGGCCAATGATGAATTATT
ATCTTGACGAGAAATGATAATGTAAAAATTAAGCTTAGTAGGATTACGCTGAGGCCCAGC
CTAGGTAACAATTGTGAGACAAGAAGTTTGGATTTCTTAGTTTCCTTCTGTGGAGATTTT
ATTTCAGGATTCTGGCAATGAAATATTTCTTTGAAACTTGTTTTGCACACTTCTGTATGC
TTCTAAGTAAACTATAAATTCTGATTCTTTAGGTGTTTGTTTCCTATAATTCCTAATTTT
CTTGGATATTTGGCACTAAGACCCTTGCTCTCTTCCTCTCACTGCATGATTTAGTAAGCC
CTACTGGTGCTATTCTATTGAGTGGAAGTGAGAGGCTACCTTTGCCAGCTGAAAAATTCC
AAATAGATAATTGAACTAGTGAAGACTGAGCTCTATAATAATTACAATTATTCATTCAGA
CAACATGAATATCATGACAGGGTTTTCTCAATAACTGACAGACACATATGATGCAATCCT
CATGAGAAAATCCTTACTTTTTACCTAGGATTGATTTTTTTAAGGATCGAGAAATATGAC
ACATTGGAATTTTGCTCAATGCATTATAGTCATTGAGGTCTAAATACAGACTAAATTTTC
TATAATATTAGTATAGTATTCTAACAGTGCTAGGATATGTTTTGATCACTGATGAATCTT
TATGACTGAAATACCCTTGCAATTGGGGTATAAATGTGAGTTACAATAATATGTGTTTTC
CCATGAAACTTGAAATTGGATAAATTGATGAGCAATCTGGTACCTGACTTTTGTCTCCCA
AGTACGTTTGGCTTCATTTTCATTATGATGAAAGTGTGTGCTGTGAACGATGCCAATGGT
AAATAAGACTTGTATGGACACTCATATGAATGACAATCAGGGCCATTCCTTCAGGCAACA
TGATTACCCTTGTGCACTCTTCTTCTCAATGAGTGACTAGCATACTTGATGGGATCTACA
AGAGGGAAACTTTACTTTTTACTAAAATTGCATTGACATAATGTTGACAAGGCTTGTGAT
TATTGGTATCATCGCTAAGAGGTGATATGCATTTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved