Pongo_pygmaeus Locus Mono:128:SNORD78
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:128:SNORD78
Pongo_pygmaeus
Mono:128:SNORD78
2a
SNORD78
1001..1064
2064
TAGCTCCTTTAACAATACTGGAACTAGAAGTTGTGGATAGCTCGTATTCATCATTCAAG
ATAGCAGCTTTACCTGGGACTCTTTTCCCACATCTGAATTAGAAGTCTCAGTCATAGGGC
CATCTAAATTGTTTATAATTCTGCCACTATAGCATTTAACCCACTTTTGTGTTTATTTAT
TTAATCATTTGTCTTCACCAATCGGTTGTAACCTGGCGAATGCATTGCCACCTCTATCTC
CCTAATTAATATACTCTTAAGGGCTTATCAAAATACATGACACATGGTGGGCATTCAACA
AGTACATCCTAAATAAATGATTAATTAATATGTTCATTTCAACATTTCCATGTGCCTTTC
ACAGCAGATGTCTTCATTATTTATCTTTGGTAAAAATAATTAAACAGTCATTTTGTAAAT
AGTCATGAATATTTACTATACTTCAAATATGTTCTAGGTAGCATAACATTTTCAAGGAAG
TATACATGATGGTTTATTACTTTATTGAGAATAAAGTCTATGGGGCAGACAATTTACAAT
ACAGTGTGATAGAAATCTAAAGAGATGCCAAAGAGTTGGTCAGGTAATGTTGTGCTATGC
CAATGTTAAGAGTTCTAATGTTAGTATTCACATAACTAATTTTCATAGTCTCAAAATCTT
CTGACGTTTTCTTCCCTTTGAAATATTTATTTTCAGGATGGTAAACTTTTTATTCACATA
ATAACTATTTTTAGGAATAAGAAGGTCAGAAGCACTAACTTTCTTTATTCCTTTCCTACC
ACATGTTTGGAATTCACAAACCAGCTTAACGGCTTAATAAAAGATTGAATTCTCCTTCTT
CTCCTTCCTCGAAAACTTCTCAAGACAGTCTAAAAAGCATTTCCCAGGTTTAATGTCAAA
ATAGAAATTAGCAGCTCAGGGCTGAACTCCTAGGAGCCCTCATTCTCTGTGAGCTCTGGA
ACCAGGCTCTATTTTGAAAATCAGGGAAAATCAAAGTTCCTCTGTAACGATGTTGTCAAA
TATCTGACCTGAAATGATTATATAGACCAATTTAATACTGAAGAAAAAAGGTTTATCATA
AAATGAGAAGACATTAAACAATACTCTGATGGTAAGGATTTCACGTAAGAATGTATGGTT
TTGATCTCTTGGAACAAAATTGACATTGAACTAAGACATGCCAACCACACAGGAGTGGCA
TGGGTTTTAGTCACAGTATCTTGAGTTTGGTGAGTTACAATAGAGAGCCTGTGTCACTCA
GCTCCACAAATTCCACCACCACGAAAAGTTTCCAGGGGGTGGTAGAATATGTTTGTCCTC
TTTTGCTTGCAACCCTGGTAAACTGCTCAAGAGGAATTTTCTCATTCCAGATGAGAACAA
ATAATGCCCTTTCTCTTCTAGACAAGTGACTATTTCTTCCCCCAAAACCACAGATGCACA
GAATAGTGATAAAAGTACAAACTTATATGCTGCCTCCCATTGAAACTTCCAAAGACCAAA
AAGGGAAAAAAAAAAATGTGAGGGGGCTTAGCCAAAAGACTTATTGAGGCTATACAGATT
ATCCTACATTTAGGCAATATATGATCCTGGTGTAGGGCTGATACATAGTGACGCTGGGGT
AGGGTTGGAGATAAGTATTATACTAATAGTTACATGTTCTCAGAAATCTGGGTCCTTTGA
TGTCTGGCCAGAAAAGGAATAGCAGTTCTGTCAGAAGACACAGTAATTGCAAGAAGAGTA
GCACAGACTAGGTGCATATTCTGATGCCAGTAGACCTTTTCAGAAAAGGTCAGCCTGTAA
CAGAAATGGCTTTTACTACAGTACAGTCCAGATTCCCAATTGTGTTGACATGTTGGGCTA
CCCAAGCACATCACAGGTACAAAGGAATTAGGATGCTGGGGCTTATTTGGGCTAAATTAC
TCACAGGTGCTTCTAACAAAGGTGGCAGATTGAACATACACATTTACCTCTATATCCTCC
CTAAATCCCATGAAATGACCAAAAACGTGTGAAATAAACCCAAAAGACAAAAGAATTGAA
TAGGAGATGGGAGCGACCCAATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved