Pongo_pygmaeus Locus Mono:283:SNORA40
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:283:SNORA40
Pongo_pygmaeus
Mono:283:SNORA40
5
SNORA40
1001..1116
2116
TATTATAAAAGCCACCCAGTCTATGATAATTTGTTATAACACCCTTTACTGTGATAGAA
ATAAACATGGAAATTACAATAAGACCTCTACAAGATAGCAGAAGAGAATATATTTAAACT
TTGAAATAGGAAATTTTTTTAAATTTAATTTTATTTATTTATTTATTTATTTTTGAGACA
GAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGCGCGATTTTGGCTCACTGCAAGGT
CTGCCTCGTGGGTTCACGCCATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGG
TGCTCGCCACCACGCCCGACTAATTTTTTTGTATTTTTAGTAGAGACAGGGTTTCACCAT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTATGATGATTTAATATTATTATATATGGCAACTGTTTCCAGTGATCG
GGGTTGTATCAGTTCTGGGTCAGCATTCTCTACTCGATGTGATCGGGTGCACAGCGATAT
TTTTTTTATGGCAGTTCCCAGTACCAGAGTTATTCTAACAGACCCTCCTGCTCCAAGGTG
GATCAGCAGACCACAGCTGCTGAATAGAAATTTAAGGCATAAGTTAAGGCAGAACAGAGT
GGAAAACTACTCTACAATATTTCATAAAGGATTCACATGTACACAGTAACAGTTACTAAT
ATAACTAATAAATAATAGAGTATTCACTACAATGATAGTCATAAACGTTGAGGTCTTGTG
GACAAAGACTTATGGACAGGTGCAAACCACAAATCCTCTTTTGCAACCCAGAACTTATTG
TTCAGTATGAGTTTTGATACATGTAAGAAGGGATATTATGATGCCTGAGACAGTTAACTA
ATGGGAGTATTGATAGCCATAAAGGTTGGTTCCAGGCCAGGCACAGTGGCTCAAGCCTGC
AATCCCCACACCAAAGTGGGAGTATTGCTTAAAACCAGGAGTTCAAGACCAGCCTGGGCA
AGATAGTAACAAACACCTCATCTCCACAAAAATTTTAAAATTAGCTGGGTATTGGGGCAT
GTGCCTGTAGTTGCAGCTACTCAGGAAGCTGAGGCTGAGGCAAAAGGATTGAGCACAGGA
GTTGGAGGCTGCACTGAGCATTGATGGTACCACTGTACTCCAGCCTAGGTAACAAAGACA
GACCCTGACTCTTAATAAAAAAATATTGATTCTAGGACTGTAGAATAGATAGTTAAACAG
CATGGGATATGAGGGAAATCCTCAGCAGTATTAATTTTTCATTCCATTTCCATGTTGACC
ATACATACGATGGCTTTTTGTTTAAAGGGCTTTTATCTTGAGAACATGATGTCTGGAGTT
AAAGGATTGGGCATATTCCACACATCTGTACTATTCTTGAATGTGATCGNNNNNNNNNNC
ATGTTGACCATACATACGATGGCTTTTTGTTTAAAGGCTTTTATCTTCGATAACATGATG
TCTGGAGTTAAAGGGATTGGCATATTCCACATTATCTGTACTATTCTTGAGTGTGATCGT
TTAGGAATGAATATGATTTGAATTCATACATGTTAAGAGAGGGTGTCAAATTGAGAACCA
GGCAGATCCACCACCTAAAGTAAAAAGGACCCTAAAGTAAATTGGTTGAAGAAATTAGAT
CCCAAAGATTCTTGCTGAATTTTGAAGTCTTCATCAGCATATCCATATCAAAAGGAGATG
ACAGAAACCAAAATAAAAGGATTATGGGCTGAAAAGGACAACTGGATTAAAATAAGCATG
ATTTCATTAAAAAATGGCTAACGAAGATAAATCTTTTGACTACAGCTCTTTAGAGGATCT
AAAGTGACCTTAACGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved