Pongo_pygmaeus Locus Mono:214:SNORA3
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:214:SNORA3
Pongo_pygmaeus
Mono:214:SNORA3
8
SNORA3
1001..1111
2111
ATTACATACACACACAAAAATATCAACAGAGCAAACAAAACTTAAGATTCTAAGAAGGC
TGGGGAGTTGAGCCACTGATGTGTGCGTGCTTCTCTATCTCCTCTTCCTGTGTACAGATT
AGGATGTGACAGAGTCTTAATTTAAAGTTTGAAACTATAATCCTCATTTCCACGAGAATT
TGTAGTAGTAGGGAACCTGAGCTCAGCAAAGGAGGCTGCGGACGAGCCTCCAGTCTTTGG
TGAGCCTCTTGTCTTCCTGTAGACTTCACCTCCTCACCTGCCTTTGCGATCCTGGGTTAC
CATGTTTAGACTCAACTCTAGCTCAGCACCCTCTGGTCTTGGGTAGGTATCAAAAATTAA
ATCTTTTTGTCTAGCCTTGATTTCACACCCCCTCCCTTATATCTTTCCTATAACATCCAA
TAAGAGGATATCCTGCTTTCCTCCCTAACCTAGATCGACTCGCCATGGGCACCACCATGT
CTAAATGTCAGCAGGACACTTCCAGCCTTCCTCAGTTTGTAACGGACCATTATGGTGCAT
GGTCTTTTAAATCTGCAATAGGTACACCAGGGGTGACCCCAAATTTTAATTTCCCCTTTA
TGGATCCTGGAACTATGATATCCTGAAACATTTAAAGGAGGACCAGGGAAGTCACCATGC
CAACTAGATTGTTTCATGTATACATGGAAAGATTAGGTTCTGACACAAGTTGCCAAGAAA
GTAACCAAAACCTCACTAAAGATGTTGAGAGAACCACTGAGAAGTCCTGTCAATTTCCTG
TTCAAGTGTGACCCACTAAGACCACACTCCGCCCCCGATCTCACAACAGCTAAAGACCAA
ATAATTGACCTCCTCCTCCTTCTCTGCCCCCAGAGTCACCCAAAATCGCCTTGAGTAGAG
TTCCAACAAGTGTCCTGATGTTCCACTTTCAAAGATGCCAACCGGAGATGCCCAGAGCTT
TGCTATAAAGTGCCTCTTAATCTCATATAAAATTCGGCCTCACCAAGACTCAAGTCACAT
TTCGAGTGTCCCGGTGTGTTAGGGCACTTGCAGAGAATCTGCTGGTCTTGATTCACTGGT
GGGGGCAATCGGTGCCCAGATTAGAAACATGCCCTGCCTGGGGTTTTAGACAGCAGGCTG
GCAGTCATCTTTCCTCACACCTATCAGGCAGATGGTACCTGCCATGGTGTATTGTAAAGT
TTAAAAAAATAAAAAAATTAAAAAGAACAAAGAAAAATTCAGCCTCAAACCATTAGCACT
GCAATCCTCAAGCCATTAAGAAGGCACATCCTAGAAATAATTAGAATATTTTCCATCTAG
AAAAGGCAGAATATGGCTGGGCATTGTGGCTCACACCTATAATCCCAGTATTTTGGGAGG
CCAAGGCAGGTGGATCACTTGAGGTCAGGAGCTCAAGACCAGCCTGATTAACATGGTGAA
ACCCCACCTCTACTAAAAATACAAAATTAGCTGAGCATGGTGGTGCACACTTGTAATCCC
AGCTACTTGGAAGGCTGAGGCAGGAGAATTGCTTGAATCCAGGAGGTGGAGGTTGTAGTG
AGCCGAGATCATGCCATTGCATTCCAACCTAGGCAACAAGAGTGAAACTCTGCCTAAAGA
AAAAAAAAAGAAAGAAAGAAAAGGCAGAATATTTGAATATTTCAGAATGGCTGAAAATAA
AGTTAAGTCTCTTTTCAGATAAGTCTAGGCTGCAGAAGGCCAGGAGAGAAAGGAATTGTT
TGTATTTCAAAAAAAAATCTTAGTCGACTAAGAGGCATTAAGAAGATACATTCTATATAG
ATAAAGAGAAACTAGAGAAAAAGGAAAATTAAAGATTTGGGGACTAGGTTATGATAAAAC
CAGCTTAGAGAATCACTTGGATTTATGCATTGTAAACTTTGGTATAATATAATAATATGT
TGGTAGGAAATGTTATATATTATAAAGGGAAGCTCAAAGAAGAGAGAGAATAAATTTTAA
AGGCTTTAATATCATTACTATTTACTAAATTAAATTGTAATGAAATACATGAAGCTACGT
GGGTTCTAATATTGCCAGAAATTGAATAGTAGAAGATAGAATTGGGTGCCATCCAGAACT
TGTGCATATGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved