Pongo_pygmaeus Locus Poly:11:SNORD89
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:11:SNORD89
Pongo_pygmaeus
Poly:11:SNORD89
2a
SNORD89, SNORD89
1001..1114, 5716..5829
6829
TACTGTGACAGACCAAGGTAAATTGTTTTTGATAATTACAGAAGTATGATTTCTTAATC
AGCAGCTGTCAAACATAGTGTTCCTTAATTTAAAAGCTTGAACACTAAATTATAAATTGG
AGAGGTTGGAATAATTACGGTCATATCTCTAGAAACACAAGTCTTTAGTAGCAAAAAAGA
AATTAGCAAGGGAAGAAAACTGTTCAGTACTTTGAAAGGAAAAAGTTTTCATTGATAGAA
GTTTTTTTAGATGAAAATTAACATGATAAACAAGTGACAGGCCAGGTGTGGTGGTTGAAG
CTTTTTTAACACCAACAATTTGGGAGGCCAAGATGGGAGGATCTCTTGAGCCCAGGAATT
CAAGACTAGCCTAGGCAACAAGACAAAACTCATCTCTACTAAAAATTTAAAAAATTAGCC
AGGTATGGTGGCACCTGCCTGTAGTCCCAGCTGCTTGGGAAGCTGAGGTGGGAGGATCAC
TTGAGCCCAAGAGGTTGAGGCTGCAGTGAGCTGTGATCACACCACTGTACTCCAGCCCGT
GCAAGAGTGAGACCCTGTCAAAAAAAAGAAGGGACAAATACTAACGAGAGTTTTTGCTAA
AAGTTTTAAGTTGATAAGATGCAGAGAATTGGGGGAATGTATAATAAATCAGATTTCATT
GTTATATTATTTACCACATGAATCACTTTCCTCCTAACTGTTGTCATAGGAGCCGTGTGT
TCGCATGTCATGTGGACCAGTATTTAACTTTGGAAACCGCGGGTGGCATGGATAAGGAGG
CAGTGTCCGTGACTGTGCCGCTCTCCGCAGCCCCCTGCCTGCTGTCCTGCTTCCTCGGCT
CCTCGGTGTCTGGACTGGCATTCTGGGTTTCCCAGCAGAAAACTAAAGGGCCAGAGAGGT
GTAAAAACACACACCACTTGGCAGGTAATAATTTCCCCACATGCTATCTTTTTAGGGATC
CTGAACACACAGCCTTTCCCAAAAGACTGCTCCCTCCAGCTACTGAGGAATGATGACAAG
AAAAGGCCGAATTGCAGTGTCTCCATCAGCAGTTTGCTCTCTGTGGGCACACGATGACAA
AATATCCTGAAGCGAACCACTAGTCTGACCTCAGTAGCAGGATTGGAAGCTTCATGCTAT
GGGAGCTGTCAAGAAAGGCATCCCAAAGAGAACTGAAATTTAAAAATAATAATAGACCTT
CAGGAATAGGTGACTGTCCCCATATACTGGGGATGAAATACCCAATGTAACCAAATTCCC
CAGTAAGATCACTTAGTTTGGCAATAGTCTTTTCTTTTGAGCATGTTGAAGTTTATTTGC
TCAATGAAGGCTGAAATGATAAGTCGGTATATATGTATTACTAAGTAGAACTTGAGGTAA
TTATATGTTTTAGTCAAAAGCAGTTTCTGTGGGCTTGGTATAAAACCTACTTTGTGATTT
GCTAAAGCACAGGATGTTGACTCAAACCAAAACTAGTTTTGTAGTTAATGTGTGTTGTGT
TTCTGTGACTTAACAGTCAACTAGAAAAGCCACCTACAACATTCCCAGCTACTTAAGTTT
TAAAAGTTTTTTTAAAAACACTTGTCACCATATTTTGAAAAATACTAACATTTGGATTAC
TAGTTATAAAAGTATAATTTCTACTGTGTCATAATCGGCCATGCAGCTGGAGACTTGCCC
TCTTTGTACAGCAAAGTTGTGGAAAAAAGTATTTGCACTACATTTATTTAAACATTGGGG
AAAAAAGCCAACCCGTGCTTCTTTCTGAGATGTAGGGCTGTATTATTGGCTAGTGAGAAG
CCTGGGAACACTAGGACTTTGTGTGGGCTGATTGCAGGTATCAGATCCGGGATTATACAG
GTACTCTTGGAAGTATCTTGGGGATTTTCCTGATAAGAACAGTAGTGATTGCATAAAAAT
AACAGACAGGATGTAAAGTGAAATCAGCAAAATATCTTAGTAGACAGAGGGCGCTGAAAT
TTTAACAAATGTGTAAAAAGTTCTTCCTATGCATTAATTTTCCAGATACCCTTAAAAGGT
TTAAGGAATGTAATTCAAAATACTGTTAAAAAGACATGTGACCATCATTCTCCAAGAGAA
TGTGAATCATTTAGTGTGCTACTTAAAATTAGGTGTAAATGTATATGTACACTATAAGAA
TAAAAATCAATACCATTTCTTTAAAGCTTTCTAAAAGAAAATTATTTCTAATAGTTACAT
TTTAGGCTCTGAAACTATTTTTCTTTTGAAATAGCTGCTTTCTACCCTAAGATATTACTT
ATTGCTGTCTTCTTTTTAACAGGTGATTTGAAGATATTAAAGCTAGAAATTGGAACTAGA
AAGTCAAAAGAATTCAAGGCATCTTAACATGACAGTTGAACTCATTTGATTATACTTAAA
AAAGTTTATTGCAGTTATTGACTCTCAATTTTTTTTTTTTTTTTTTGAGTGCAGTGGTGC
CATTGTTGCTCACTGCAGCCTCAGTCTTCCAGGCTCAAGAAATCCTCCCACCTCAGCTTC
CAGAGTAGCTGGGACTACAGGTGCATGCCACACCCTGATAATTTTTTTTTCCCAATATAA
ACGAGGTCTTGCTGTGTCCTCCAGTCTGCTCTTGAACTCAAGTGATCCTCCCACCTTGGC
CACCCAAAGTGCTGGGATTGATTACAGGCGTGAGCCACCAAACCCAGCCACCAATTTTAC
TTTAGGTAAACTTTCATTTGCAAGCTTTTGTTGGTGTTGCAAGTGTAAATCTCTGTTTTA
TAAAATATTCTATAAATATAACCACTATTCCTTGTAAGCTATTTAAAATAAATTTTAAAG
TCTTTCAAGTAAACACCAATATTGTGATTTTGATCCTCATTTACGAAGTCCCTATTTGAG
AACCTGTCTACTAAAATGTATTTGTAACCCCAAAATCATCACGTGCGGTCATTTTCAGAC
ATGCACAGAGCAGTGAATGAGCCAAGCTGCCTGACCCACACGTTCCTGACGGAGGCTGAA
GGACGGGATGCCCTGCCTTGTTTCCTCTCCTACTACAAGCAAGTGTCCTTTCATAGTCTC
TTCAGTACCCTGTTCTTTGCATTTCTGCACTTTCTGTTGGCAATTTCACTATTTAAAATG
GCCCTCAGGTGTGGCAAAATATTGCCTACTGCTCTAAGGGCAAGGCTGTGATGTGCCTCA
TGGCCTGTTAGATCAGCTTCACTCAGGCATGAGTGATGGTGTTGGCTGTGAGTTCAATAT
TTTATTATGCCAGAGAATCAATCAGTAGGTCCTGTAGGTCCTGGAACCTAAAGCTAGGTT
GTTGAAACTGCCACTCCTAAAGTACTTCAGTAATAAGCTGTTCTTTTCCCAATGCTAACG
TGCAAAACGGGGATGCTCGCTTTTAGGTGTAAAAAGAAATCTCTGTTGCCATCGTTTTAA
TTGTCTGAAGGCATTCCTCTGATAGATGGGCTTAGTTCATTATTTCCTCTAAGCAAACAT
TCTTAGACATTTCTTTTGTAAGAAAAACTAAGACAATTTATTATAAATCTTTAGTACTGC
TCTTTCTCCAGAGTTTTGAGACTGGAACTTGTACTTATCTTAAAATCACAGGCTTGGTTT
CCTTTAACTTTTTCAAGGTGTTAGTAATTCCTGTTGAACAGATTATCTCCCTGTAAATAT
GCTTTGAAAATACCTCAGTAAAAGGAATTTCTCATGATTTCTTAAAGTAAAAAATACATC
AGATAACAGTTGATAAAAAGAACTTTAATGGAAGGCACTGTTGTCCAAAATCACATAAAG
GGTAAGAGCCCACACGGTACCACCCTGCTCTCCTACTTCTCAAACCCACATCCACCACCC
AGACAGGAGGGTGCAGACCCCACAGGAAATTACCTCCCAGAGCACTGACTGATATTTTTC
CTTAAAACAAAAAAATGGCTGTCTCAGACTAATAACAGAACATCTTAAGAGAAAAAAAAA
AAAACTATACCAGCTATTACAGCCTGGTAATAGAAGCAAGCAAAGTTATCGTGCATACTC
TAAGAAATAAGAACTGTCTAGTAATGTCCTAGTAATGGGTAAGCAACATTGTGTTAGTGA
TCCGTCCCAAATGTAATACCCCTGCTCAAAACGCCACGTTAAGTTTTAGAAAAAACCATT
GATTGACCCAGACCAACNNNNNNNNNNGTAAGGGGCCTGGAAAGCAGGAAGTGACTGCTC
ATCTAATCCATAAAACTATGTTAACAGATTGGAGCTGTTTGCAGACAAGGTTTTCCAAAG
ACAGCAGAAAATTTCCATGCTCTGAGCACTGGAGAAAAAGGATTTGGTTATAAGGGTTCC
TGCTTTCACAGAATTATTCCAGGGTTTACGTGTCAGAGTGGTGACTTCCTTCACACGCCA
TACAGCACTGGTGGCAAGTCCATCTGCAGGGAGAAATTTGATGACAAGAACTTCATCCTG
AAGCATACAGGTCCTGGCATCTTATCCATGGCAAATGCTGGACCCAGCATGAACGTTTCC
CAGTTTTTTATCTGCACTGCCAAGACGCCAAGACTGAGTGGTTGGATGGCAAGCATGTCG
TCTTTGGCAAGGTGAAAGATGGCATGAATATTGTGGAGGTCATGGACACTTGGGGTCCAG
GAATGGCAAGATCAGCAATCAGCAAGATCACCATTGCTGACTGGACAACTGCAATAAATT
TGACTGGTGTTTCTCTTAAAAAAAAAAAAAATACTGTGACAGACCAAGGTAAATTGTTTT
TGATAATTACAGAAGTATGATTTCTTAATCAGCAGCTGTCAAACATAGTGTTCCTTAATT
TAAAAGCTTGAACACTAAATTATAAATTGGAGAGGTTGGAATAATTACGGTCATATCTCT
AGAAACACAAGTCTTTAGTAGCAAAAAAGAAATTAGCAAGGGAAGAAAACTGTTCAGTAC
TTTGAAAGGAAAAAGTTTTCATTGATAGAAGTTTTTTTAGATGAAAATTAACATGATAAA
GAAGTGATAGGCCAGGTGTGGTGGTTGAAGCTTTTTTAACACCAACAATTTGGGAGGCCA
AGATGGGAGGATCTCTTGAGCCCAGGAATTCAAGACTAGCCTAGGCAACAAGACAAAACT
CATCTCTACTAAAAATTTAAAAAATTAGCCAGGTGTGGTGGCACCTGCCTGTAGTCCCAG
CTGCTTGGGAAGCTGAGGTGGGAGGATCACTTGAGCCCAAGAGGTTGAGGCTGCAGTGAG
CTGTGATCACACCACTGTACTCCAGCCCGTGCAAGAGTGAGACCCTGTCAAAAAAAAGAA
GGGACAAATACTAACGAGAGTTTTTGCTTAAAGTTTTAAGTTGATAAGATGCAGAGAATT
GGGGGAATGTATAATAAATCAGATTTCATTGTTATATTATTTACCACATGAATCACTTTC
CTCCTAACTGTTGTCATAGGAGCCATGTGTTCGCATGTCATGTGGACCAGTATTTAACTT
TGGAAACCGCGGGTGGCATGGATAAGGAGGCAGTGTCCGTGACTGTGCCGCTCTCCGCAG
CCCCCTGCCTGCTGTCCTGCTTCCTCGGCTCCTCGGTGTCTGGACTGGCGTTCTGGGTTT
CCCAGCAGAAAACTAAAGGGCCAGAGAGGTGTAAAAACACACACCACTTGGCAGGTAATA
ATTTCCCCACATGCTATCTTTTTAGGGATCCTGAACTGTGTACACAGCCTTTCCCAAAAG
ACTGCTCCCTCCAGCTACTGAGGAATGATGACAAGAAAAGGCCGAATTGCAGTGTCTCCA
TCAGCAGTTTGCTCTCTGTGGGCACACGATGACAAAATATCCTGAAGCGAACCACTAGTC
TGAACTCAGTAGCAGGATTGGAAGCTTCATGCTATGGGAGCTGTCCAGAAAGGCATCCCA
AAGAGAACTGAATTTAAAAATAATAATTGAACTCAGGAATAGTGACTGTCCCATATACTG
GGATGAATACCCATGTACAAATCCCAGTAGATCACTAGTTGGCATAGTCTTTTCTTTGAG
CCATGTTGAAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved