Pongo_pygmaeus Locus Poly:22:SNORD14
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:22:SNORD14
Pongo_pygmaeus
Poly:22:SNORD14
11
SNORD14, SNORD14
1001..1083, 1426..1512
2512
GTCTGTCAACGCCAGAAACCAGTGGATCCTGACAATTACACAGTGATTTACATTTTGAG
GGGGTGCTCCAGCTGTTCTTTCACCAGCATTAATCCATTTGTTGGAGTTTGCATATATAA
GTATACTAGTTATCAATCTGCGGTCTTTTCTTTTTTCCTAGACTGTTACCAATGCTGTGG
TCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTA
TTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCTATTGCTTATG
GCTTAGACAAAAAGGTATGTACCATTTGTGATGCAAATCCAGATTATTTTAAGATTAATT
TGATCCATCACGAATTTAAATGATTGTTTTTAATGGCAGGTTGGAGCAGAAAGAAACGTG
CTCATCTTTGACCTGGGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGA
ATCTTTGAGGTCAAGTCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAAC
CGAATGGTCAACCATTTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAG
AACAAGAGAGCTGTAAGACGTCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCT
TCCAGCACCCAGGCCAGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACC
TCCATTACCCGTGCCCGATTTGAAGAATTGAATGCTGACCTGTTTCGTGGCACCCTGGAC
CCAGTAGAGAAAGCCCTTCGAGATGCCAAATTGGACAAGTCACAGATTCATGATATTGTC
CTGGTTGGTGGTTCTACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTTTTCAAT
GGAAAAGAACTGAATAAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGGTAAC
AATGGTATCTCAACCCTAAAGGCAGGCAGGCCCAAGGTGACTCACTGAGTGATTGTTAAA
CATTCGTAGTTGCCACCAAAAGCTTGGCTAATGATGGCAACACCTTCCTTGGATGTCTGA
GCGAGTGATATAGTTGTTAAAACAGGAGCTATGTACCGGGTTTTCTTTTTAGTTTTTTTT
AATGTTAACTTTTTGTTTGCTAGCTGTCCAGGCAGCCATCTTGTCTGGAGACAAGTCTGA
GAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTGGTATTGAAACTGC
TGGTGGAGTCATGACCGTCCTCATCAAGCGTAATACCACCATTCCTACCAAGCAGACGCA
GACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATTCAGGTATGTTTCTGTAC
TTTCGTTTGGCTTACTGAAAACAAATAAAGGGAAGTCTTGACTGACTCGCTATGATGATG
GATTCCAAAACCATTCGTAGTTTCCACCAGAAAGTCTCATGTTGGCCAGTTCCTTCCTTG
GATGTCTGAGCGACCATTCTTCCTTAGCAGGACTCTAGCACTATGACAGAGACCTGAAGT
CCATTGCAGTAATTCGTTTTATTCCCTACCAAGGTTTATGAAGGCGAGCGTGCCATGACC
AAGGATAACAACCTGCTTGGCAAGTTTGAACTCACGGGCATACCTCCTGCACCCCGAGGT
GTTCCTCAGATTGAAGTCACTTTTGACATTGATGCCAATGGTATCCTCAATGTCTCTGCT
GTGGACAAGAGTACAGGAAAAGAGAATAAGATTACTATCACTAATGACAAGGGTAAGTAG
GCACGATCATCTGGTCTTGACAGGGATCATAATGGTATTTCAGTTGAGTTACTGGTGCCT
AAGGGCATCTAGCTAAGAGAAACTAGAGTTACACAGGTAATTCTTTTCTAGGCCGTTTGA
GCAAGGAAGACATTGAACGTATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAGA
AGCAGAGGGACAAGGTGTCATCCAAGAATTCACTTGAGTCCTATGCCTTCAACATGAAAG
CAACTGTTGAAGATGAGAAACTTCAAGCAAGATTAACGATGACGACAAACAGAAGATTCT
GGACAAGTGTAATGAATTATCAACTGGCTTGATAAGAATCAGTTTGTGATTTTTTTTTTT
CACTCTGTAGGGAAGGGGATGGTAAACCAAGTTTGAGTGGATTTCAGTATAGGTCACATG
ATGATGGTCCAANNNNNNNNNNAAACAAAAAAAAAAAACATGCCAGGCGTGGTTGCTCAT
GCCTGTAATCCCAGCACTCTGGGAGGCCAAGGCAGGCGGATTACCTGAAGTCAGGAGTTT
GAGACCAGCCTGGCCAATATGGTGAAACCCTGTCTCTACTAAAATACAAAAAGTAGCCAG
GCGTGGTGGCATGCACCTGTAGTCTCAGCTACTCGGGAGGCTGAGGCAGGGGAATCGCTT
GAACCTGGGAGGCAGAGGTCGCAGTGAGCCAAGTTCGTGCCACTGCACTCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved