Pongo_pygmaeus Locus Mono:19:SNORD81
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:19:SNORD81
Pongo_pygmaeus
Mono:19:SNORD81
7
SNORD81
1001..1076
2076
GTGATGCAAATGTAGAGATAAGCACCTCGACTGGGAAAATACATAAATATTTGGAAGAA
TAGTTTCAGAATGAGTTAAAAATCAGAAGTTACCATATATATGGTACTAAACTTTCTTCT
TCAAAGCATGTTTCCATACTTAGTTGGACTAAATAAGCCTTAACTACTTTTCAGCCCCCA
ACTGCTATGATTCTATCTTGCTCAATTCTACAAAATCACTGTGAGATAAACATGGCAGGC
ATTGTTAATTTGCAGTTAATGGACTATAAAATTGAAGATTTAATAGATTGCATAACTTAC
TCCCAACCACACAGATAGTTAATACCAAAGCCAGATAAGAACTTAACTTGATTTGAGTCC
TAATTATTCTATTTATTATGTAAAAACTCTCATTCGTGCTTCATGAAAGTAATCATCAGC
TATCCCATTTCATAGATTGAAATCTCTGTGCTATGTTTACAAAGCAGCACATTGAATAAA
CGAGGCTTGTTCCCCCAAATGATGTAATATTTGCTGTTTGGTTAGTAAAAAGTTTCTGCT
GCCTCCTTTGGCATTTCACATGCACAATTTATGAAAGTAGTTGCTAACCTCTACTTATAG
TGCTGCTTTCAAATAACTTCTATTTCCAGAGGACTTGTAAAAAGTAATTTAAGTGGCCCA
AACCTGATCACTATGTATATTTAAAGCTTGTCAGCTATTGTTGGTATGACATGGAGTTCC
TTTCTGCTTAGGGTCACCCAGGATGTGAAATAAGTAAGACAAAATATGCTTTTTTTTTTT
CAGAGAATTTTAAAAAGGGAGTGACCTTAAATTGGTCCCTAAACTCCTAATCCAACAACC
AGAATTTGTTTAGTTCTGTTATATACAAGATTCTGTGGACATATAAAATATACTATACGA
CCCTCATCCATAAAGAACCTAGACTAAAAACTTGAAGGTTTTCATGAACGTGTAACAGTG
CCTATATTCAACATGACAAAATGTTCCATATAAAAGTCTTACAAATACATGATGATCTCA
CCTCAGTTTGAACTCTCTCTCTGATTACTTGATGACAATAAAAGATCTGATATTGTGTCA
AGAAAGAATAAAGAAAAAAAAGGGCTTACATTGTATGTGCTCCAAAATGTCTATAGTACA
GTTCATTCTGAAGCCGGGGGGGCGCTATTAGATGACTTATTTTCTTTAATAATGTTTTTT
CCAGATCATAAAAGACATATATGATAATTACTTTCAACAGTTGAGTTCCCCTAGAAAACC
AACCAGAAAAATCTATTGACTAAGCAAAGCTAATTTTATTAAACCTACCACAGCAGCAAA
GAGGATAATCTTGACTACATCTTAGTGTCTCAGAAGGAATAGGTAAAATAGGATATTTCC
AGGGCTGTGGGGTCAGGTCTCAAGTGGTATAAGTTGAATCTTTCAAAGCAGGGAACTGAT
TAGGATTCAGCAAAGTTCACATTATAATAGTTTAGTGAGGTGAAGGTCTTAAAGTGAGTC
TTAATAAATGAATTGTTTAATAAACAAGCTGTTGCCCTGAATAATTTGCTCAGATGAGTT
AATTGTTTGGATATATTGGCTTTCAAAAATTTTATGATGCAACAAAGTTCTGAATTGGTT
ATACTGCCTCATTTTCCTGGCCAAACATTTGGTAAAATAATGAGAGTAACTCAGGAGCTC
TGCCTGGTTTTCATCTCAATTTTGTCCCTCAGTTCTCCGGAGACATGAAACACACCTTGC
CCACCCAGTTTCCTAATATGTTAAATGCAATTTGTAATTATTGTTTATGCTTTAAAGGAT
ATCTGACCACATTCCAGGGGCCTCCAATGAAAACAGCACAGATTTTTATCATCAGATGTA
GTTACTGAATTTTATCTAAAGCTAAATGTGTTTTTTAAATTTAGCATTAGGACCTTACAA
TCAAAGAATAAATATTTGCATAGAGATGGAAAAAAAATTGCTTCTCAGTCTTTTGGCTAA
GATCAAGTGTAGAGATGGAAAATAACATTTATTTGGGGGGAAGAAGCCTTTTATTTGAAG
TTTGAAAACTTTAGACCTATTATTCCTCAAGAAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved