Pongo_pygmaeus Locus Mono:87:SNORD74
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:87:SNORD74
Pongo_pygmaeus
Mono:87:SNORD74
12
SNORD74
1001..1080
2080
TGTCATATTTGAAAACTATATTTATTTACTCGTATATCACCAAGTACTTTTAAGTAACT
AACGTTGTTTTATGGAGTCAAGACTTACAAAACCATTGAGTGCAGTGGTGCACACCTGTT
GTCCCAGCTACTTGGGAGACTGAGGCAAGAGAATTGCTTCAGCCCAGGAGTTCAAGACCA
ACGTAGGCAACATAGTGAGATCCCGTAGTGAGACCCTGTCTTTAAAAAATAAATAAATAA
ATAAAATGCTTATACAACCCTCTTGAAAAAACTGGCCTGGGACCTGCTTTACAAGGTTTC
CAGCCTTACTCTTTTTTCACTGAGTTTTTGCGTTTCATGAAGGCATCACAATATACCTTT
TTTAAAACAACCCATAATTGGAAACTTAACTAATCAAAATGAGCCACCTCTCCTCATTCA
TACAAATGAATGGAAGAGATCGGAGCCCACACAGCTGCCAGGCTCTATGCAGGGCACTTG
GCACATAATCTGCAGGATCTTTAAAATTTTATTTTATTTTATTTTATTCTTATTTTATTT
TACTCTTATTTATTTATTCTTATTTATTTATTTTATTCTTTTTTTTCTTTTTTAGAGTTT
TTTTGAAAGTTCTTGTCAGACGGGTAATGTATCAACATCATAACAAGGTTTAAGGGAGGT
ACAGCTCACACATGAGCATGAAAACCCAATTATCATGCTTATGAACTACAAAAGGATCAC
AGGATATTTTTGTAAGTGCCTACCCAACAGATCTCCCCTCCTTTTGTGGTACAATATGTC
CAGTGTTGAACTAGCAGCATTCACACTTCCCCACAAGTGTCACAAAAGGGAGACTCTCTC
CCAAGTTTCCCCAGCAGTAAAACCTGATTGGTCTAAGGTCTGCAGGGTGGTTCTAGTCCT
CTTGTCAGTGATTAATTAGACATGACTGTATAACATGGCTGGGAGGTGGGAGCAGAAGAA
GAGATTCCAAAAGGAAAGGGTTTATGCTCTTAAAAAGAGCTATGTGATGCCTCTGATGAA
GCCTATGTTAGTAGAGACATCTGAGAGTGTAGATGAATGCCAATGGCCCTCATGGAAAGA
GAGAGAGATGAGAAAAAGCACACTCTTTTTTTGCATCTACATGTGACGTCTGGAATTACA
GCAGCCATTTTGTGATCATGAGAGCAGCTGGCTTGGCTAAAGACAAAATTTGTCACACCA
AACATGGGCAGAGAAGAAAGAAGATTCTGGATTCCCGATAACATTTTTGAGCCACTGGAC
TAACCAAGACTGGAATTGGTCTTCCTTGGGGCTTCTTAATATGTGGGATAGTGAATTTTC
ACGTTGAAGTAAATTTGAATGGAGTTTTCTGTTTCTTATAGCCAAAACCATCTTACCTGC
TACAAATATTTTATTTAATTTCATCTTTACAACAGTCCTATATCTGTGGACATTCTCATT
TTATAGATAAAAATCTGAGATTCAGAAAGTTTTAGTAACATGCCCAGGCACAGTGGCTCA
CACCTGTAATTCCAGCACTCTGGGAGGCCAAGGTGGGAGGACTGCTTAAGCCCAGGAGTT
TGAGACCAGCCTGGGAAACATACTGACACCCTGTATCTACTAAAAAAAAAAATTACCTGG
GCATGATGGCACATGCCTATAGTCCAGCTACTCAGGAGGCTGAAGTGGGAGGATTGCTTG
AGCCCAGGAGATCAAGGGTGTAGTGAGCTGTGATCGTGCCACTGCACTCCAGCCTATGCA
GCAGAGCAAGACCCTGTCTCAATAATAATAATAATGATGGATAGAACAACCACACAGAAG
ATAAGCAAGGAGAGAGAGAACTTAAACAACATAATAAACCAACTAGAGCTAACAGACATA
TACAGAACACTCTACACAACAGCATATACTTTCTTCTGAAGTGCATGAGACATTTTTCCA
GAATACACTATACGTTAGGCCACAAATTAAGTCTCAATACATTTTAAAAGATAGATATTA
TAGGCCTGGCACGGTGGCTCATGCTTGTAATCCCAGCACTTTGGGACGCCAAGGTGGGTG
GATCATCTGAGGTTGGGAGTTCAAGACCAGCCTGACCAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved