Pongo_pygmaeus Locus Mono:132:SNORA64
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Mono:132:SNORA64
Pongo_pygmaeus
Mono:132:SNORA64
2a
SNORA64
1001..1134
2134
TTGGGTGGTGGTGGGTGCTGAAGAGGATGGAGGAGAGATGAAAGGTGGAACCAAACAAA
AGAAAACCATGAAAAACAGCCAGCAGGAATGATAGGATCATATGTATGTGTTTATGTAAA
AATGAATAAGGGGTGGGGAATTTAACTATGTATTGCACCTCTACTTTCTCTAGCTCTATC
TCAAGCATTGTAAAGAACAGAGGACAGCTCTGTTGGCTGGAAGCTTACAGTCCCTTTGGG
AAAACAAGGCAAACCCATGCAGCACTCAGTGAGCAAGCCAACATAATTCAACATTCGAAT
TCCCTATCTCCTGAGTTCTTATCACTCTATTATATTGTTTATTTAACAAGCATTTCTTCA
GGCCACACTAGGTGCCAGGTGTGATCACTGTCCCTGAGGAGTCAAAAAAGCAATATAATT
AGAGATGGATATCTAGTGCTAAGTAAATATTATCAAATAGGGTTAAAATAGCTGTAATTT
GGACAGAGAGAGGTGCTGTATGAGATTTTGTCTTTATAGTCTTTGTAGTCCATCACGTCA
GTATCTAGGGCTGGAAAAAGACCTTATCACCCATCTAGTGTAGCTTCTATATATTACTTA
CGAGGAAACTGAGGCCCTGGGGGAGCAAATGACAGTAGTCCCTTCCAGTGATTAGCAGAG
CTGAACTACAGCCCACAGCTCAAGAACTAGGCTTGTTTCTGTCCACCACACAATAGTGTC
TTCAAGCAAAACCGAGAACAAATAATGTCTCAGAGTGAAGAATTTGATGTTTTAGTGATC
TTTCATCTGAAGCAGCAAATATAATAGGGAAAATATGGTGCTATAGGTTCAATTGTCTCC
CCCCAAAAGATGTATTCAGGTCTTACCCTCTGGAACCTATGTATGTGAGCATATTTGAAA
ATAGAGCCTTTGCAGTATCGATGACTGCTACACCTCAGCCTGGGGCTGCACTGCCACCCT
GGGCTACTTCAGTAGGTGGTCCACGCATGGGGCATAGCCATGGTCTCTCAGCTCTGCTTA
ACCACATGGGTCCAGTGTGTGCTTTGGCGTGTTTTCAGGGAGACAGAGAAAGGCTCTCCT
AATGCACGACAGACCTGCCCAGAATGGCCTCTCTGTTCCTAGGAGTGTGACAATTTTTGG
GTAAAAAAAAAAAAAAAAAAGAAAATAGAGCCTTTGCCTATGTAATGAAGTTAAGATGAG
GTTGTACTGGATTGGGGTGTTTCCTAAATCCAGTATGACTGGGGTCCTTATAAGAAGAAG
GAAATGTGGATGCAGAGATACAGACACACAGAGGAGAAGGCCACACCAAGATGGAGGCAG
AGATGGAATGCTGTGTCTGTCTGTAAGCCAAGGAGCACCAAGGCCTGCCAGCAACCACCA
GAAGCTAAAATAGGCAAGGACGGATCCCTCCCTAGAGACTTTGGAAGAACATGACCCTGT
AGACACCTTGATTTTAGACTTCTAGCCTCTAGAACTGTAGGATAATATATTTCTACTGTT
TTAAGCCATGCTAATATACATGGCTTGGAGTTTGTTAGATCTAGGTAAAATCTTGTTTTT
GTTATTTACAAAACAGATGATCTTGGACAAACCAACAAACTTCTTTGATCCTTGGCTTCA
TTACTGTAAAACAGGGATAATAGCAGCACCTCGGCTGCTGTGAGGATAAAACAAGGTAAC
TCATGGACAGCACCAAGCTCCTAACCACTCTACTGAACTCTGGGAAAGGAAATGGACCAG
GCTGGGCTCTGGGAAAGTAGCCGGCTCTGAGTCCCTCTTCCCCTGAACCTCATGATGCCA
TGTGGAACAAGGCTGGCCAATTCATCTTTTTGGCTGCAATTAACCTACAGTAATGGCTGG
CATGCTGTAGAATAGCTATGCTGTTGGCTGAAGCCTATCCCTCCCTGACATTAGTAACAA
CTTAATGGTCTAGAGAGTGATGCTGAGGCAGGAGAATGGGGTCTGGAGGGAGGGAACATA
AAGCCAATTCACACTGACTTCCTAGAACGAAATCAAATGGAAACACTACAGCTATGACAG
GAAATAGCCTCTCCATTTACATAGGGCATACACCAACTAAATGACTGTAACTTTACTGCA
TTCTCCTCATTTACATAGAGTGTACACCAGTGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved