Pongo_pygmaeus Locus Poly:15:SNORD115
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:15:SNORD115
Pongo_pygmaeus
Poly:15:SNORD115
15
SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 3087..3166, 4992..5052, 6277..6352
7352
ACACACATGAAACATTCAGCAGAATAGACCACATTCTGGGCTAGAAAATGCACCTCAAC
AAATTTAAAAGAATAGAAATCATACGAAGTATGTTCTCAGACTACAATGGAATGAAAGTT
AAAAAAATCACTAAAAAAAAGATAGCTGAAAAACATGAAAATACTTGGAGGTTAAACAAC
AGACTCCGAAATAACTGAAGGTGACAGAAATCTCAAGATAAATTTTTAAAATATTTCAAA
CTAAATGGAATTGAAAGCACAGCTTATCAAAAATTTAGGAACACAACAAAGGCAGTGCCT
ACTGGAAAATTTATACCACTGAATGTATGTTAAAAAGAACAAAGATCTAAATAAATAATC
CTTCCCATTGGGAAGCTAGGGGGAAAATTCAAATTAAATTCAAAGTAAGCAAGTAAAAGA
AATAATAAAATATGAATACAATTCTGAGTGGCCTGATATCTGATTTCTGAAGCTGAGTTT
TATGTGGCTTTAGAAGTTTCATGTTATGAGTGTGAATTGGCAAGTGACCATGGCGATTGT
TTCTGATATGGCCACCTCAATTACATGGAGAAGGGATGATCGGTGGCATCATCCCAGTTC
TGCATGACACCACACCAGTGATTCTCCAAAGTCAAGAAACCTGTATATGTTGTCCTTCTT
GTGTTTGGTGAATCTTTGGTCTACAGACTACATAATGGGCTATTTCTGGGGTACTGATCA
TTTTGCTCCATTAAGGAAAACCATGCATGAGCCATATAACTATGGGAAATAATGTTTTCG
TTTTTGACACCTGGCCTACTCCTCTCTTCTTAGGCGAGAGCAAAGGAAGAGCACCACTTG
GCCTGCTGCACCCAGGGCAATTTATACCATCCAGGTATCCAGCACTGAATATGTAGCAAC
TCCAATCCACCATAGAACATTAATCTATCTCTGATAAGCATGCTAATATCTACGATTCTG
CCTTTGTGGGGAGATGACTCCACAGATTAACCCCCTGGCTTGGGTCAATATTGAGATGTT
ATATTGTCTTCGACAGGGAAGATGACATAAAAATTATGTTCAATAGGATTATGTGGAGAC
TTAACATAAGTGACAAACCTGAGACAAGAAGTTAGAAATCCTTGTTTCTTTTAGGTGAAT
AATTTTGGAGCTTGAGAAAACGACACCGTTGTGGCGAACTTGCTTTGCCAAACCCTGTGT
ATGCATTTCTGGGTAAACAACACATTTTCATCTTTTAAGCATTGTTTCCATTATTTGTAA
TTCCTAGTAGTATGAGACATTTGGGACTCATTCCTTTTCTTCTTCTCTCATTGTATCTTT
CATTGTATCTTTCAGTGCTGCAAGAGATGCATCATCCCATTAATGAAAGCAGAGTGACTG
CCTTCGTCACACATACATTCAAAATAGACCACTGGGCTAGTGATGATTCTCTCTTAAGGC
TATTATGTTTACTCATTTAAAAAATCTGAATCTCAGTGTAGATTTTCTTCTCAGTGAGTG
ACTGACCTATCTGATATGATGCTATGACAAAATCTTTACTTTTTACTTGAATTTGATGGG
ATTGAAAGTTGAGAACATATTAATTTATTTTCTGTTTCACTTGATTAATAATGCCCAATC
TAACATGCAATGTTCACTTGGGTACATATTTACAACTACATCAAATTTTTTCTTATTTTA
CCTTAAAAGTGTTAAGATATTGTAATGTTATGGCCAGTTTACTCACTGGTAAACTTTTCA
TAACAGAAATATCATGCCAGTGGACACAAATATGTAACATCAGTAATTTGCTTTGCTCAT
GAAACAGAGAACTGAATAAGTTGATGGGTAAACTAGTGTATGAATTATAAACCCCAAATA
TCATGTGACTTCATCATTTTCAGTATAATGAAAATACAGGCTGTGAATGCTTCCAGTTGG
TCCTGAAAGGGCCTTTGAGGTGAGTAGGTTCACCAAAGCGGCAACATATGTGTCCCAGTG
TGCATTCTACTCCTCAGTAAGTGACTGGACATTCTTTATGGCTTCCTCATGATTAAAACA
AGTCTTTTTATTGAAATTTTACTGAAATAATGATGAGACAATGTAATATTCTTTTCATCT
ACATATAAGAGTAGACATAAATTCACCTCTACCTATTTTTTTTTTTTTTTTTTTTGAGAC
GGAGTCTCGCTCTGTTGCCCAGGCTAGAGTACAGTGGCGTGATCTCGGCTCATTGCAACC
TCTGCCTCCCGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAG
GCACGTGCTACCATTCCTGGCTAATTTTTTTGTAATTTTAGTGAAGACGTGGTTTTACCA
TGTTGGTCAGGCTGTTCTTGAACTCCTGACCTTGTGATCTGCCCACCTCCGCCTCCCAAA
GTGCTGGGATTACAGGCTTAAGCCCCCACGCCTGGCCTTCACCTCTACCTATTATAATAT
TTTCATGTTATTCCATTTTGTGATGTTTGTGGGTCATTTGATGAGGGTTCACAATATGAA
AACTAGGCATTTTGGCCAAGATGCGTGTAAATGAATACAACTCCATGTGCCCTGATAACT
GATTTCTAGATCCTGAGATTCAAGTGTCTTCCAGAGTGTCTGTATTTTATGAAAGTTCAT
ATACAGTAAACCATGCCAATTGTTACTGATACAGCTTCCTTGAATATATAAAGCGATGAT
TAATGGGATGTTTTGTTTCTGCATAAGACCACTGAATTGCTTCTCCAAAGACAAGTGACC
TGTATGATTTGTCCTTATTATATTTTGTGAACCAGTGTACTCAAACCTTTATAATAGGTC
ATTTTTTTAGTATTGTCAATATTGTTCAATTAACAAAAACCATGCATGACTCATATACAC
AGGTGAGATGTAGTTCTCCCTTTGACATTTGCTCTACATCTGCCCCTTATATGATGATAT
GGAAGAAGAGCACTCTTTGGCCTGTTGCAACTGGGACAGTTGACAGCACCCAGGTGTCCT
GTAATGGAAATGCTCTTGACACCAATGCATCCTAGCATCAGAGCTTCAGGAAGCCTTCTC
AAGTGTGCATGGGGAGTACCATGTCTTTCATCAATAATGAAACCTTCTAATGTCTTGGTG
AGAAATAATGCCTTAAAATTACACTCAATAGGATTATGCTGAGGTTCAGCCGGCCTAGAT
GAAAATGCCGGAACAGATAACAGTGACTTCTTATTTCCCTTCAAGGGGAATTTTATTTTG
AACTTGAAATAACAAAATCTTTATGGGTAACTTGTTTGCCCAACTGTATCAGTGCACCTA
TAAATGAACAAAAAATTCTCAGCCTATGAGCTTTGTTTCAGTGATCTGTAATTTCTAGTA
GTATGATATATTCAGGTCTCATTCTTTGGCTTTTTCTCTTATTGTGTGTTTCAGTAAGAC
ATGCTGCCAAGAGATGTGCCATTCTGTTATAAAAGATCAGTGGCTTCCTTTACCGACGTG
TATATTCTATCTAGAACATTGAGCTATGGAAGACTCCCACTTAAGGGAATTAGTTTTACA
CCTTCAGGTAATCTGAATTTCATTATGAGTTTTGCTTTATGATATAATCCTCATGACAAA
ATCTTTACTTTTTATCTGAACTTCATACAATTTAATATTGAAGATTTTTTAAATTCACTG
TTACCTAGTCCAATATTTAATATACATTTGGCTGTAGATACATGACTAGACAAAATTTTT
TTATATTATTATTGTGGGGCTCTAACAGTGTTTCACTGTTTTGAGTTACTGATGAACTTT
CTGTAACTGTGAGACCATGGTAATGGAAGAGACCCTGGTAACGGAGAGGAGAATGTGAGA
ATCAATATGTACTTTGCCTATGAAACTTAAACATTTAGTAATTTGATCACTAAATTGATA
CCCAAATTTCAGTTCCTATCATGTGTAAACCAAAAGGTACCTGAGATTTAGAAGTTTATT
TAGAAGTGGATTTTGCCAAGGTTAAGGACATGCTCAGAAGAAATAAACCCAAAATCACAG
AAACCATCTGGGGTCTATATCTTTCTCCAAAGATGATTTTGAGGGCTTCAGTGTTTAAAG
GGGAAAAGCGGGCTGGAGGGAAAAAGGGAGGGTATGATAATCCGTATGTTCCAAGACAAA
AGGAACAGGTAGGGGTATAGTCAATAATGTATTCATCTCACGCTCAGTAAATCAGCACTT
TACATAAGATAACATGAACATAGAGAAGCTACCTGTGGAGATCTTTAACCTTTAATCTGC
AGCTATCTGCTTAAGATCAAAAGGAAATTCTTGCATGACTCAGCTTTCAGCTTATTTTTT
TTTTCTTTTGGCATTGTAAATTGGGGTCCCAAGTTTTTATTTTCCTTTCACGCATGTGAC
CCCACTATTTTAGAATAATGAAAGCACATGTTAGAAATGGTGACACTTATTCCTAATATG
GACTTTGAAATGACTGGGTTCACAAATTTAGAATCATGGGTCTCACTGTAGGTTTTTATT
TTCAATGAGTGACTGGCCTACTTGATGGAATTCTTTCAAAAAATGTTCACTTTTTACTGA
AATTATGTTAAAATAATGTTGGAATATGTTCAGTCATGTTTACCATCTCTATAGTATGAC
ATATGATAATATCGCAGATTACTCAGTGTCAAAAGCCTGGCATATCTTGTCCTTATGATG
TTGATGAGTCAATGGTCTAGAGCCTTAGTAATATGTCTTTTTGTGGTAGTATGGACAATA
TCTGTCCACTAAGAAATAGCCTGTGTAAGCCATATACACAGGAACAATTTATGTCTGATT
TTGAACTGCAGTCCCGTTCCTATGCCTGTAGATAAAGACTGCTGAGAAGAGCAACCTCTG
GTGTTGCCACAGAGGCAAGTGCTACCACACAGGCATGCTGCAGTGAATTTAACTGATCCT
CTGTCCCTGCAACCGTTGTTTAAGGATGCTATTCTGGTAAGGGTTTACAAGACAATGTAA
ATATTGTATAAAGAGTATCTTCAGGAGACGTAATAATGTAAAAATCATGCTCAATAGGAT
TAAGCTGAGGCTCAAAATAGTGCCAATCCTTGCAAGAAGGTATGAGAAGTCATTAGATTT
GGAGGGTATGGGTTATTCCATTTCGAGCTTGGTAGGAAGAAACCCTTTGGGGAATCTTAC
ATCATTTGCCTCTATCTACTTCTAAAGGAACTTTTAAAATTCTTTTATCTTGTCTTTATT
CTTAATACTCATACATTATTAGAGAGAATATCTTAGTTTATTCTTTCCTCATGGTGTGCT
TCAGAATGTTCATCCAGCAAGAGGTGTGTCATTACACGGATTATATATATGAGTTCTGTC
TTTCGTAATTAAAAAATTCGAAGTGGACAATTTGAATATTAAACATTGGCCTTCAAAATG
ATTACATTTACCTTTTCATACAAAATTAGTGAGCAATAATCTATTCTTTCCAATGAGTGA
CTGATCTAATGGGGTCCTCATTAAAACTTCTTTTTTTTTTTTTTGCCTGAATGTATTTTG
ATTTAAAGATGTGACATTTAGTAATTCATTGCAATCAACTCTTTAGTGATTGCACAAATA
GACAATCCTTTTCTATTATTTTATTTTTTGGGTTGCTGTGTATGGTGTTATGATGTTTGT
GGATCATTGAGGCACTACTCACAACTGAAAGACTTTGGCAATTTTAGGGAATGGCTTGAG
ATTCAGCTATAGGTTACCCTTGATTGAAACTGAATACAATACAGGTAGTCTGAAATCTCA
TTTCCTTATCCTGAGTCTCACTCAGGTGTCATTAGATTCATTATAAAGAAATGCATACAC
TATGTATGATGCCAGTTGTTACTGATATGAAGACGATAAGAAGCTTTTATTTCTGCAGGG
AAATAATCCCTTACCAGGTCGTCAAAAGACATGATACCTATGTGCTTGGCCCTTACTGTA
CACAGGGAATCAATGGTCTACCACAGCTTAAGTAACGGGTCATATTTGGTGTATCACACA
TCTCAGTCTTGTAGAAATTAGGAACAGCAATTAGGAGTCATGCACATATAAGAGATGTAA
TCCCACCCTTTGACTATAGCCTACTCTTGTCTTTTACAGAAAAGACTGTGGAGGAAGAAA
ACCCTTTACCCTGTTGTTCAGGGAGAAACTGACACCACTCAACTGCCTGGCACTGAAAAT
GTGGCATCCAGTCCACTTTACCACCAGTGTTTAAGGAAACCATCTCTGGTAAGCATATTT
GATCTAAGTGTACATATGCATATGAGTGCCATGGCCTGGGTCAATGATGAGATGTTACCT
TGAAGAGAAATGATGATGTAAAAATTAAGCTCAGTTGGATTACACTGAGGCCCAGCCTAG
GTAACAATTGTGAGACAAGAAGTTTGGATTTCTTAGTTTCCTTCCATTGGGGATTTTATT
TTGGGATTCTGGCAATGGAATCTTTCTGTGAAACTTGTTTTGCACACTTCTATCTATGTG
CTTCTAAGTAAACTATAAATTCTGATTCTTTAAGTGCTATTTAAGTTTCCTACAATTCCT
AATTTTCTTGGCTATTTGGCACTAAGACCCTTACTCTTTTTCTCTCATTGGATGATTTAG
TAAGTCCTACTGGCACTATTCTATTGAGTGGAGGTGAGAGGCTGCCTTTGCTGACTGAAA
AATTCCAAATAGATAATTGAACTAGTGAAGACTGAGCTCTATAATAATTAGATTTATTCA
TTCAGACAACGTGAATATCATGATAGGGTTTTCTTCTCAATGATTGACTGACACATGTGA
TGCAATCCTCATGAGAAAATCCTTACTTTTTCCCTATGATTGATTGTTTTCAGGGTTGAG
AAATATGATACATTGGAATTTTGCTCAATGCACTACAGTTATCGTGGTCTAAATATACAG
ACAAAATTTTCTGTAATGTTAGTATAATATTTTAACAGTGCTAGGATATGTTTGATCATT
GATGAATCTTTATGACTGAAGGGTCCTTGCAATTGGGGTAAAAATGTGAGTTTCAATAAT
ATGTGTTTGCCCATGAAATTTGAAATTAGATAAATTGATGAGCAATCTGGTGCCTGACTT
TTCTTTCCCAAGTACGTTTGGCTTCGTTTTCATTATGATGAAAGTGTGTGCTGTGAATAA
TGCCAATGGTAAATAAGACCTTTATGGACACTTATATGAATGACAGTCAGGGCCATTCCT
TCAGGCCACATGATTATCATTATGCATTCTTCTTCTCAATGAGTGACTAGCATACTTGAC
AGGATCTACAAGAGGGAAACTTTATTTTTTACTAAAATTGTATTGATATAATGTTGACAA
GTTTTGTGATTATTGGTATCATCTCTAAGATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved