Pongo_pygmaeus Locus Poly:25:SNORND104
snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus Poly:25:SNORND104
Pongo_pygmaeus
Poly:25:SNORND104
17
SNORA76
1263..1395
2395
AAGGAAAACAGGGAGGCAATAAAGATAACCGGCAACTGTGACTGCTGGTGTACTGTGTC
CTCCCCCAGTTAAGCAAACTCTCATTCATCCACCTGTATGTCCAGGGAATGGGCTCAATC
AACTCTGCGAAGCTTTCCCGAAGTCAGGCTTTCTGTCCTTTGGGCTTCTACAGTAGGCTG
TTCATAGCGCTATGTTAGTATTTATTAAAGTTTTGCAGTCCCAGGGAGTTTTCCACGTCA
CCCTGCCCTTTAAATACCTTTGTTTACCACTTAGAATGTGCCAGGCAATTGGCATTAATT
CACCGAATCCTTACAACTTTTTTTTTTTTCGCGGTGTGTGTGTGTGTGTGTGTGGGCGGG
GGGGGTATTCCTAATTTCCAGAAACTGAAACTCAGAAAGGTTAACTAAGCAAGGTCACAG
AGCGAACGCATCACAAAGTCAGGATGTGGTGCAGATCGGTCCATTTTCAATACAAGCTCT
TTCTACCACAACAGGTTACTTTGCACTCGGGGACAGTTTTTAACTTTACATTCTCAACTC
CTGTCCTAGCTCCTGGCACAGAACATGTCATCCAAGTTAGGCATCATCGTCGCCTGCTCT
TGGTGAAGTTTTCTTTTGCGTACTGCAGAGAGACGTGCTCATTAGCGGTTGGCGATGGAG
ACGCTGAAATGCAAATGGATTTGAGACTGAGCGACTCCCATCTCTATGGTTGGTATGTGA
CCCATCTATCCTCTGGAGGACTCAGCAAGGACTACCAATCACCAGACAAGTTTACGCGCA
CGTGGTCGCAAGTTGAACTTGCTATTGGTTAACGGCAGTAAAGCCCGCCCATCAGCGCTG
GTCGGCTCCTTTAAGAGAACGCCATCGCCACCTGCCTGTCTTTCAGCGCCTGCAGATTCC
GGGAGGTTAGGTTGTATTCCTGGCGGGTCGTCTGGCTGGGTGGGCCCCGGAGGTCGTGGT
CTGGGAGTACGGAGTCGTGGGGAGGGGGGGTGGGCCGGCTTGCTGTGATGACATTCCAAT
TAAAGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTGGAGTCTGAGCCTGCCCGAG
CGGAGCTGGGAGGGGGCTGGCGGGCGGGCGGGCGCGCGCACACACCCGCTGATCTGTCAC
TCTCGTTCTTGTAGCTCCCAGCCGAGGACGTCGGATGTCATCGTCCTTGCTGCTTTGCCA
CCCCATTCCCGTCAATAAAGTGGTTTGAACCCAACCCTGGTGTCGGTGTGTGTCGTTGGC
GACGCGCTGTCTTTGAGCCCCCGCCGAGCCTCCTCGTGGCGCCGGGGGTCAATCTGCAGC
GCTAGAGCATGTGCTTGCGCATAACTGGGGCCGCCTGGCCCCCCGCGGGCGGCCCTTTTA
ACCGCGAGCGACAATAAGTAACCTGACTGTCCGGCTGCTAGACGGGGCAATTTTCCAGGT
GTTTTGCCACGACAGGCCTCAATACGTAACACCAAGGCTGGAATGGCGTGTTAGGGGGGC
GGTGGCTGACCGGGATACGCGGACTCTGCTGTGTAATGAGTGCCCCTCTGCTCCCATACG
TTCCGCAGCCCAGCCCTCCCCGAGTGTATCGCACGCGCTGTGCCTTCGCCGTGAGTTCGA
CATAAGTCCCAAGCTGTCGCGTCTGCCATCAGACGCGCAGATTTAGTTGAAGGCAGCGTG
GAACGGCGTCTGCAGGGCTACTGTGTACTTGACATAAACGGATTCGGTGTGGAACTGCAT
GAGTTAACTCCTGACTAAAGGGTAATCGACCTGTTTACAAATAACAGCCATGCAGGAGTA
CTGACAAGCATGGGACTAAAGCTTTGGGCAGGTTAATCTGTCACTTATAAACAGTTCAAA
ATTATAGGGCGGTTGTGAAGGTGAATTAGATTTTATATATGGTTGGGGATAACATAGACA
TCTAGTTACACAGTCCAGATTCTGTGATTGGTAAAAGATCTTCCACAAGGGCTCCAGTGA
AATGTGCATCAGTTCCGAGTACAGGGCAGCAACGGTGGGCAAAGATGCACGTATGCGTTC
ACTACATGGGCATTTGATGAATGAAGGTGTCCCGAATTAAGATTATACTAGACGATGGAG
GGTGTAAACTGCAGCCCAGGAGCACCACTGCCTTACCCCTCCAGTTACGAACTTTCACTA
GATTCTTTAAATGTGGGCTGAAGATAATGGCACATAGTTTGAAGGATGTGGTGAGGATGG
CTTTGCAGCCTTAGGACTGGGCAGTGATCAACCCAGTAAATGAAAGCTGCGATTGCCAGG
TGAGGGCCCCGGTCGTCTGTACTCATTTTACTGTGCTCCTATCTGAACAGGATTCAGTAG
AAATGACTTAGATGCTTATCTAGTATTTGACATAAGATATTTATTTTGTGAAACAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved